Abstract: The growth in the volume of text data such as books
and articles in libraries for centuries has imposed to establish
effective mechanisms to locate them. Early techniques such as
abstraction, indexing and the use of classification categories have
marked the birth of a new field of research called "Information
Retrieval". Information Retrieval (IR) can be defined as the task of
defining models and systems whose purpose is to facilitate access to
a set of documents in electronic form (corpus) to allow a user to find
the relevant ones for him, that is to say, the contents which matches
with the information needs of the user.
Most of the models of information retrieval use a specific data
structure to index a corpus which is called "inverted file" or "reverse
index".
This inverted file collects information on all terms over the corpus
documents specifying the identifiers of documents that contain the
term in question, the frequency of each term in the documents of the
corpus, the positions of the occurrences of the word...
In this paper we use an oriented object database (db4o) instead of
the inverted file, that is to say, instead to search a term in the inverted
file, we will search it in the db4o database.
The purpose of this work is to make a comparative study to see if
the oriented object databases may be competing for the inverse index
in terms of access speed and resource consumption using a large
volume of data.
Abstract: The study is devoted to define the optimal conditions
for the nitriding of pure iron at atmospheric pressure by using NH3-
Ar-C3H8 gas mixtures. After studying the mechanisms of phase
formation and mass transfer at the gas-solid interface, a mathematical
model is developed in order to predict the nitrogen transfer rate in the
solid, the ε-carbonitride layer growth rate and the nitrogen and
carbon concentration profiles. In order to validate the model and to
show its possibilities, it is compared with thermogravimetric
experiments, analyses and metallurgical observations (X-ray
diffraction, optical microscopy and electron microprobe analysis).
Results obtained allow us to demonstrate the sound correlation
between the experimental results and the theoretical predictions.
Abstract: Artificial Immune Systems (AIS), inspired by the
human immune system, are algorithms and mechanisms which are
self-adaptive and self-learning classifiers capable of recognizing and
classifying by learning, long-term memory and association. Unlike
other human system inspired techniques like genetic algorithms and
neural networks, AIS includes a range of algorithms modeling on
different immune mechanism of the body. In this paper, a mechanism
of a human immune system based on apoptosis is adopted to build an
Intrusion Detection System (IDS) to protect computer networks.
Features are selected from network traffic using Fisher Score. Based
on the selected features, the record/connection is classified as either
an attack or normal traffic by the proposed methodology. Simulation
results demonstrates that the proposed AIS based on apoptosis
performs better than existing AIS for intrusion detection.
Abstract: The biosynthesis of nanoparticles by microorganisms,
on the contrary to chemical synthesis, is an environmentally-friendly
process which has low energy requirements. In this investigation, we
used the microorganism Geobacillus wiegelii, strain GWE1, an
aerobic thermophile belonging to genus Geobacillus, isolated from a
drying oven. This microorganism has the ability to reduce selenite
evidenced by the change of color from colorless to red in the culture.
Elemental analysis and composition of the particles were verified
using transmission electron microscopy and energy-dispersive X-ray
analysis. The nanoparticles have a defined spherical shape and a
selenium elemental state. Previous experiments showed that the
presence of the whole microorganism for the reduction of selenite
was not necessary. The results strongly suggested that an intracellular
NADPH/NADH-dependent reductase mediates selenium
nanoparticles synthesis under aerobic conditions. The enzyme was
purified and identified by mass spectroscopy MALDI-TOF TOF
technique. The enzyme is a 1-pyrroline-5-carboxylate dehydrogenase.
Histograms of nanoparticles sizes were obtained. Size distribution
ranged from 40-160 nm, where 70% of nanoparticles have less than
100 nm in size. Spectroscopic analysis showed that the nanoparticles
are composed of elemental selenium. To analyse the effect of pH in
size and morphology of nanoparticles, the synthesis of them was
carried out at different pHs (4.0, 5.0, 6.0, 7.0, 8.0). For
thermostability studies samples were incubated at different
temperatures (60, 80 and 100 ºC) for 1 h and 3 h. The size of all
nanoparticles was less than 100 nm at pH 4.0; over 50% of
nanoparticles have less than 100 nm at pH 5.0; at pH 6.0 and 8.0 over
90% of nanoparticles have less than 100 nm in size. At neutral pH
(7.0) nanoparticles reach a size around 120 nm and only 20% of them
were less than 100 nm. When looking at temperature effect,
nanoparticles did not show a significant difference in size when they
were incubated between 0 and 3 h at 60 ºC. Meanwhile at 80 °C the
nanoparticles suspension lost its homogeneity. A change in size was
observed from 0 h of incubation at 80ºC, observing a size range
between 40-160 nm, with 20% of them over 100 nm. Meanwhile
after 3 h of incubation at size range changed to 60-180 nm with 50%
of them over 100 nm. At 100 °C the nanoparticles aggregate forming
nanorod structures. In conclusion, these results indicate that is
possible to modulate size and shape of biologically synthesized
nanoparticles by modulating pH and temperature.
Abstract: Food contamination occurs during post process
handling. This leads to spoilage and growth of pathogenic
microorganisms in the food, thereby reducing its shelf life or
spreading of food borne diseases. Several methods are tried and one
of which is use of antimicrobial packaging. Here, papain, a protease
enzyme, is covalently immobilized with the help of glutarldehyde on
polyurethane and used as a food wrap to protect food from microbial
contamination. Covalent immobilization of papain was achieved at a
pH of 7.4; temperature of 4°C; glutaraldehyde concentration of 0.5%;
incubation time of 24h; and 50mg of papain. The formation of -C=Nobserved
in the Fourier transform infrared spectrum confirmed the
immobilization of the enzyme on the polymer. Immobilized enzyme
retained higher activity than the native free enzyme. The modified
polyurethane showed better reduction of Staphylococcus aureus
biofilm than bare polymer film (eight folds reduction in live colonies,
two times reduction in protein and 6 times reduction in
carbohydrates). The efficacy of this was studied by wrapping it over
S. aureus contaminated cottage cheese (paneer) and cheese and
stored at a temperature of 4°C for 7days. The modified film reduced
the bacterial contamination by eight folds when compared to the bare
film. FTIR also indicated reduction in lipids, sugars and proteins in
the biofilm.
Abstract: The development of the agricultural sector in Ghana
has been reliant on the use of irrigation systems to ensure food
security. However, the manual operation of these systems has not
facilitated their maximum efficiency due to human limitations.
This paper seeks to address this problem by designing and
implementing an efficient, cost effective automated system which
monitors and controls the water flow of irrigation through
communication with an authorized operator via text messages. The
automatic control component of the system is timer based with an
Atmega32 microcontroller and a real time clock from the SM5100B
cellular module. For monitoring purposes, the system sends periodic
notification of the system on the performance of duty via SMS to the
authorized person(s). Moreover, the GSM based Irrigation
Monitoring and Control System saves time and labour and reduces
cost of operating irrigation systems by saving electricity usage and
conserving water.
Field tests conducted have proven its operational efficiency and
ease of assessment of farm irrigation equipment due to its costeffectiveness
and data logging capabilities.
Abstract: The objective of the study was to select the survival of
probiotic strains when exposed to acidic and bile salts condition. Four
probiotic strains Lactobacillus casei subsp. rhamnosus TISTR 047,
Lactobacillus casei TISTR 1500, Lactobacillus acidophilus TISTR
1338 and Lactobacillus plantarum TISTR 1465 were cultured in
MRS broth and incubated at 35ºC for 15 hours before being inoculated
into acidic condition 5 M HCl, pH 2 for 2 hours and bile salt 0.3%,
pH 5.8 for 8 hour. The survived probiotics were counted in MRS agar.
Among four stains, Lactobacillus casei subsp. rhamnosus TISTR 047
was the highest tolerance specie. Lactobacillus casei subsp.
rhamnosus TISTR 047 reduced 6.74±0.07 log CFU/ml after growing
in acid and 5.52±0.05 log CFU/ml after growing in bile salt. Then,
double emulsion of microorganisms was chosen to encapsulate before
spray drying. Spray drying was done with the inlet temperature 170ºC
and outlet temperature 80ºC. The results showed that the survival of
encapsulated Lactobacillus casei subsp. rhamnosus TISTR 047 after
spray drying decreased from 9.63 ± 0.32 to 8.31 ± 0.11 log CFU/ml
comparing with non-encapsulated, 9.63 ± 0.32 to 4.06 ± 0.08 log
CFU/ml. Therefore, Lactobacillus casei subsp. rhamnosus TISTR 047
would be able to survive in gastrointestinal and spray drying condition.
Abstract: In the present work, the effect of load and sliding
distance on the performance tribology of commercially used
aluminium-silicon engine block and piston was evaluated at ambient
conditions with humidity of 80% under dry sliding conditions using a
pin-on-disc with two different loads of 5N and 20N yielding applied
pressure of 0.30MPa and 1.4MPa, respectively, at sliding velocity of
0.29ms-1 and with varying sliding distance ranging from 260m-
4200m. Factors and conditions that had significant effect were
identified. The results showed that the load and the sliding distance
affect the wear rate of the alloys and the wear rate increased with
increasing load for both the alloys. Wear rate also increases almost
linearly at low loads and increase to a maximum then attain a plateau
with increasing sliding distance. For both applied loads the piston
alloy showed the better performance due to higher Ni and Mg
content. The worn surface and wear debris was characterized by
optical microscope, SEM and EDX analyzer. The worn surface was
characterized by surface with shallow grooves at loads while the
groove width and depth increased as the loads increases. Oxidative
wear was found to be the predominant mechanisms in the dry sliding
of Al-Si alloys at low loads.
Abstract: Heavy metals are one of the major groups of
contaminants in the environment and many of them are toxic even at
very low concentration in plants and animals. However, some metals
play important roles in the biological function of many enzymes in
living organisms. Metals such as zinc, iron, and cooper are important
for survival and activity of enzymes in plants, however heavy metals
can inhibit enzyme which is responsible for defense system of plants.
Polyphenol oxidase (PPO) is a copper-containing metalloenzyme
which is responsible for enzymatic browning reaction of plants.
Enzymatic browning is a major problem for the handling of
vegetables and fruits in food industry. It can be increased and
effected with many different futures such as metals in the nature and
ground. In the present work, PPO was isolated and characterized
from green leaves of red poppy plant (Papaverr hoeas). Then, the
effect of some known antibrowning agents which can form
complexes with metals and metals were investigated on the red poppy
PPO activity. The results showed that glutathione was the most
potent inhibitory effect on PPO activity. Cu(II) and Fe(II) metals
increased the enzyme activities however, Sn(II) had the maximum
inhibitory effect and Zn(II) and Pb(II) had no significant effect on the
enzyme activity. In order to reduce the effect of heavy metals, the
effects of metal-antibrowning agent complexes on the PPO activity
were determined. EDTA and metal complexes had no significant
effect on the enzyme. L-ascorbic acid and metal complexes decreased
but L-ascorbic acid-Cu(II)-complex had no effect. Glutathione–metal
complexes had the best inhibitory effect on Red poppy leaf PPO
activity.
Abstract: Pollution of the Klip River has caused
microorganisms inhabiting it to develop protective survival
mechanisms. This study isolated and characterized the heavy metal
resistant bacteria in the Klip River. Water and sediment samples were
collected from six sites along the course of the river. The pH,
turbidity, salinity, temperature and dissolved oxygen were measured
in-situ. The concentrations of six heavy metals (Cd, Cu, Fe, Ni, Pb
and Zn) of the water samples were determined by atomic absorption
spectroscopy. Biochemical and antibiotic profiles of the isolates were
assessed using the API 20E® and Kirby Bauer Method. Growth
studies were carried out using spectrophotometric methods. The
isolates were identified using 16SrDNA sequencing. The uppermost
part of the Klip River with the lowest pH had the highest levels of
heavy metals. Turbidity, salinity and specific conductivity increased
measurably at Site 4 (Henley on Klip Weir). MIC tests showed that
16 isolates exhibited high iron and lead resistance. Antibiotic
susceptibility tests revealed that the isolates exhibited multitolerances
to drugs such as Tetracycline, Ampicillin, and
Amoxicillin.
Abstract: Natural antimicrobials are used to preserve foods that
can be found in plants, animals, and microorganisms. Antimicrobial
substances are natural or artificial agents that produced by
microorganisms or obtained semi/total chemical synthesis are used at
low concentrations to inhibit the growth of other microorganisms.
Food borne pathogens and spoilage microorganisms are inactivated
by the use of antagonistic microorganisms and their metabolites.
Yeasts can produce toxic proteins or glycoproteins (toxins) that cause
inhibition of sensitive bacteria and yeast species. Antimicrobial
substance producing phenotypes belonging different yeast genus
were isolated from different sources. Toxins secreted by many yeast
strains inhibiting the growth of other yeast strains. These strains show
antimicrobial activity, inhibiting the growth of mold and bacteria.
The effect of antimicrobial agents produced by yeasts can be
extremely fast, and therefore may be used in various treatment
procedures. Rapid inhibition of microorganisms is possibly caused by
microbial cell membrane lipopolysaccharide binding and in
activation (neutralization) effect. Antimicrobial agents inhibit the
target cells via different mechanisms of action.
Abstract: Turbulent flow in complex geometries receives considerable attention due to its importance in many engineering applications. It has been the subject of interest for many researchers. Some of these interests include the design of storm water channels. The design of these channels requires testing through physical models. The main practical limitation of physical models is the so called “scale effect”, that is, the fact that in many cases only primary physical mechanisms can be correctly represented, while secondary mechanisms are often distorted. These observations form the basis of our study, which centered on problems associated with the design of storm water channels near the Dead Sea, in Israel. To help reach a final design decision we used different physical models. Our research showed good coincidence with the results of laboratory tests and theoretical calculations, and allowed us to study different effects of fluid flow in an open channel. We determined that problems of this nature cannot be solved only by means of theoretical calculation and computer simulation. This study demonstrates the use of physical models to help resolve very complicated problems of fluid flow through baffles and similar structures. The study applies these models and observations to different construction and multiphase water flows, among them, those that include sand and stone particles, a significant attempt to bring to the testing laboratory a closer association with reality.
Abstract: Among agricultural residues, sugarcane bagasse is one of the most convincing raw materials for the production of bioethanol due to its availability, and low cost through enzymatic hydrolysis and yeast fermentation. A pretreatment step is needed to enhance the enzymatic step. In this study, sugarcane bagasse (SCB), one of the most abundant agricultural residues in Thailand, was pretreated biologically with various microorganisms of white-rot fungus—Phanerochaete sordid (SK 7), Cellulomonas sp. (TISTR 784), and strain A 002 (Bacillus subtilis isolated from Thai higher termites). All samples with various microbial pretreatments were further hydrolyzed enzymatically by a commercial enzyme obtained from Aspergillus niger. The results showed that the pretreatment with the white-rot fungus gave the highest glucose concentration around two-fold higher when compared with the others.
Abstract: Information technology is changing rapidly and the users’ expectations are also growing. Dealing with these changes in information technology, while satisfying the users’ needs and expectations is a big challenge. IT managers need to explore new mechanisms/strategies to enable them to cope with such challenges.
The objectives of this research are to identify the significant challenges that might face IT managers in higher education institutes in the face of the high and ever growing customer expectations and to propose possible solutions to cope with such high-speed changes in information technology.
To achieve these objectives, interviews with the IT professionals from different higher education institutes in Oman were conducted. In addition, documentation (printed and online) related to these institutions were studied and an intensive literature review of published work was examined.
The findings of this research are expected to give a better understanding of the challenges that might face the IT managers at higher education institutes. This acquired understanding is expected to highlight the importance of being adaptable and fast in keeping up with the ever-growing technological changes. Moreover, adopting different tools and technologies could assist IT managers in developing their organisations’ IT policies and strategies.
Abstract: The aim of this study was to determine the antimicrobial effect of Helichrysum arenarium L. essential oil in "in-vitro" condition on the growth of seven microbial species including Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Saccharomyces cereviciae, Candida albicans, Aspergillus flavus and Aspergillus parasiticus using micro-dilution method. The minimum inhibitory concentration (MIC) and minimum bactericidal or fungicidal concentration (MBC, MFC) were determined for the essential oil at ten concentrations. Finally, the sensitivity of tested microbes to essential oil of H. arenarium was investigated. Results showed that Bacillus subtilis (MIC=781.25 and MBC=6250 µg/ml) was more resistance than two other bacterial species. Among the tested yeasts, Saccharomyces cereviciae (MIC=97.65 and MFC=781.25 µg/ml) was more sensitive than Candida albicans while among the fungal species, growth of Aspergillus parasiticus inhibited at lower concentration of oil than the Aspergillus flavus. The extracted essential oil exhibited the same MIC value in the liquid medium against all fungal strains (48.82 µg/ml), while different activity against A. flavus and A. parasiticus was observed in this medium with MFC values of 6250 and 390.625µg/ml, respectively. The results of the present study indicated that Helichrysum arenarium L essential oil had significant (P
Abstract: This paper conducts a comparison study using KES-FB and PhabrOmeter to measure 58 selected warp knitted fabric hand properties. Fabric samples were selected and measured by both KES-FB and PhabrOmeter. Results show differences between these two measurement methods. Smoothness and stiffness values obtained by KES-FB were found significant correlated (p value = 0.003 and 0.022) to the PhabrOmeter results while softness values between two measurement methods did not show significant correlation (p value = 0.828). Disagreements among these two measurement methods imply limitations on different mechanism principles when facing warp knitted fabrics. Subjective measurement methods and further studies are suggested in order to ascertain deeper investigation on the mechanisms of fabric hand perceptions.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: Recent growth in digital multimedia technologies has presented a lot of facilities in information transmission, reproduction and manipulation. Therefore, the concept of information security is one of the superior articles in the present day situation. The biometric information security is one of the information security mechanisms. It has the advantages as well as disadvantages. The biometric system is at risk to a range of attacks. These attacks are anticipated to bypass the security system or to suspend the normal functioning. Various hazards have been discovered while using biometric system. Proper use of steganography greatly reduces the risks in biometric systems from the hackers. Steganography is one of the fashionable information hiding technique. The goal of steganography is to hide information inside a cover medium like text, image, audio, video etc. through which it is not possible to detect the existence of the secret information. Here in this paper a new security concept has been established by making the system more secure with the help of steganography along with biometric security. Here the biometric information has been embedded to a skin tone portion of an image with the help of proposed steganographic technique.