Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Both prognostic and diagnostic modes of a 3D baroclinic
model in hydrodynamic and sediment transport models of
the Princeton Ocean Model (POM) were conducted to separate
prognose and diagnose effects of different hydrodynamic factors on
transport of suspended sediment discharged from the rivers to the
Gulf of Thailand (GoT). Both transport modes of suspended sediment
distribution in the GoT were numerically simulated. It could be
concluded that the suspended sediment discharged from the rivers
around the GoT. Most of sediments in estuaries and coastal areas are
deposited outside the GoT under the condition of wind-driven current,
and very small amount of the sediments of them are transported
faraway. On the basis of wind forcing, sediments from the lower
GoT to the upper GoT are mainly transported south-northwestward
and also continuously moved north-southwestward. An obvious 3D
characteristic of suspended sediment transport is produced in the
wind-driven current residual circulation condition. In this study, the
transport patterns at the third layer are generally consistent with
the typhoon-induced strong currents in two case studies of Typhoon
Linda 1997. The case studies presented the prognostic and diagnostic
modes during 00UTC28OCT1997 to 12UTC06NOV1997 in a short
period with the current condition for pre-operation of the suspended
sediment transport model in estuaries and coastal areas.