Abstract: Virtual reality (VR) is a rapidly emerging computer
interface that attempts to immerse the user completely within an
experimental recreation; thereby, greatly enhancing the overall
impact and providing a much more intuitive link between the
computer and the human participants. The main objective of this
study is to design tractor trailer capable of meeting the customers’
requirements and suitable for rough conditions to be used in
combination with a farm tractor in India. The final concept is capable
of providing arrangements for attaching the trailer to the tractor easily
by pickup hitch, stronger and lighter supporting frame, option of
spare tyre etc. Furthermore, the resulting product design can be sent
via the Internet to customers for comments or marketing purposes.
The virtual prototyping (VP) system therefore facilitates advanced
product design and helps reduce product development time and cost
significantly.
Abstract: Advances in the field of image processing envision a
new era of evaluation techniques and application of procedures in
various different fields. One such field being considered is the
biomedical field for prognosis as well as diagnosis of diseases. This
plethora of methods though provides a wide range of options to select
from, it also proves confusion in selecting the apt process and also in
finding which one is more suitable. Our objective is to use a series of
techniques on bone scans, so as to detect the occurrence of
rheumatoid arthritis (RA) as accurately as possible. Amongst other
techniques existing in the field our proposed system tends to be more
effective as it depends on new methodologies that have been proved
to be better and more consistent than others. Computer aided
diagnosis will provide more accurate and infallible rate of
consistency that will help to improve the efficiency of the system.
The image first undergoes histogram smoothing and specification,
morphing operation, boundary detection by edge following algorithm
and finally image subtraction to determine the presence of
rheumatoid arthritis in a more efficient and effective way. Using preprocessing
noises are removed from images and using segmentation,
region of interest is found and Histogram smoothing is applied for a
specific portion of the images. Gray level co-occurrence matrix
(GLCM) features like Mean, Median, Energy, Correlation, Bone
Mineral Density (BMD) and etc. After finding all the features it
stores in the database. This dataset is trained with inflamed and noninflamed
values and with the help of neural network all the new
images are checked properly for their status and Rough set is
implemented for further reduction.
Abstract: The high efficiency power management IC (PMIC) with switching device is presented in this paper. PMIC is controlled with PFM control method in order to have high power efficiency at high current level. Dynamic Threshold voltage CMOS (DT-CMOS) with low on-resistance is designed to decrease conduction loss. The threshold voltage of DT-CMOS drops as the gate voltage increase, resulting in a much higher current handling capability than standard MOSFET. PFM control circuits consist of a generator, AND gate and comparator. The generator is made to have 1.2MHz oscillation voltage. The DC-DC converter based on PFM control circuit and low on-resistance switching device is presented in this paper.
Abstract: In this study, too, an attempt was made to reveal the
place and effects of information technologies on the lives and
education of gifted children based on the views of gifted. To this end,
the effects of information technologies on gifted are general skills,
technology use, academic and social skills, and cooperative and
personal skills were investigated. These skills were explored
depending on whether or not gifted had their own computers, had
internet connection at home, or how often they use the internet,
average time period they spent at the computer, how often they
played computer games and their use of social media.
The study was conducted using the screening model with a
quantitative approach. The sample of the study consisted of 129
gifted attending 5-12th classes in 12 provinces in different regions of
Turkey. 64 of the participants were female while 65 were male. The
research data were collected using the using computer of gifted and
information technologies (UCIT) questionnaire which was developed
by the researchers and given its final form after receiving expert
view.
As a result of the study, it was found that UCIT use improved
foreign language speaking skills of gifted, enabled them to get to
know and understand different cultures, and made use of computer
and information technologies while they study. At the end of the
study these result were obtained: Gifted have positive idea using
computer and communication technology. There are differences
whether using the internet about the ideas UCIT. But there are not
differences whether having computer, inhabited city, grade level,
having internet at home, daily and weekly internet usage durations,
playing the computer and internet game, having Facebook and
Twitter account about the UCIT.
UCIT contribute to the development of gifted vocabulary, allows
knowing and understand different cultures, developing foreign
language speaking skills, gifted do not give up computer when they
do their homework, improve their reading, listening, understanding
and writing skills in a foreign language.
Gifted children want to have transition to the use of tablets in
education. They think UCIT facilitates doing their homework,
contributes learning more information in a shorter time. They'd like
to use computer-assisted instruction programs at courses. They think
they will be more successful in the future if their computer skills are
good. But gifted students prefer teacher instead of teaching with
computers and they said that learning can be run from home without
going to school.
Abstract: For Common R or R-L load to apply arbitrary voltage,
the bridge traditional inverters don’t have any difficulties by PWM
method. However for driving some piezoelectric actuator, arbitrary
voltage not a pulse but a steady voltage should be applied.
Piezoelectric load is considered as R-C load and its voltage does not
decrease even though the applied voltage decreases. Therefore it needs
some special inverter with circuit that can discharge the capacitive
energy. Especially for unidirectional arbitrary voltage driving like as
sine wave, it becomes more difficult problem. In this paper, a charge
and discharge circuit for unidirectional arbitrary voltage driving for
piezoelectric actuator is proposed. The circuit has charging and
discharging switches for increasing and decreasing output voltage.
With the proposed simple circuit, the load voltage can have any
unidirectional level with tens of bandwidth because the load voltage
can be adjusted by switching the charging and discharging switch
appropriately. The appropriateness is proved from the simulation of
the proposed circuit.
Abstract: This paper presents a neural network based model predictive control (MPC) strategy to control a strongly exothermic reaction with complicated nonlinear kinetics given by Chylla-Haase polymerization reactor that requires a very precise temperature control to maintain product uniformity. In the benchmark scenario, the operation of the reactor must be guaranteed under various disturbing influences, e.g., changing ambient temperatures or impurity of the monomer. Such a process usually controlled by conventional cascade control, it provides a robust operation, but often lacks accuracy concerning the required strict temperature tolerances. The predictive control strategy based on the RBF neural model is applied to solve this problem to achieve set-point tracking of the reactor temperature against disturbances. The result shows that the RBF based model predictive control gives reliable result in the presence of some disturbances and keeps the reactor temperature within a tight tolerance range around the desired reaction temperature.
Abstract: Analyzing brain signals of the patients suffering from the state of depression may lead to interesting observations in the signal parameters that is quite different from a normal control. The present study adopts two different methods: Time frequency domain and nonlinear method for the analysis of EEG signals acquired from depression patients and age and sex matched normal controls. The time frequency domain analysis is realized using wavelet entropy and approximate entropy is employed for the nonlinear method of analysis. The ability of the signal processing technique and the nonlinear method in differentiating the physiological aspects of the brain state are revealed using Wavelet entropy and Approximate entropy.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: This study investigates the role and impact of English loan words on Japanese language in travel brochures. The issues arising from a potential switch to English as a tool to absorb the West’s advanced knowledge and technology in the modernization of Japan to a means of linking Japan with the rest of the world and enhancing the country’s international presence. Sociolinguistic contexts was used to analyze data collected from the Nippon Travel agency "HIS"’s brochures in Thailand, revealing that English plays the most important role as lexical gap fillers and special effect givers. An increasing mixer of English to Japanese affects how English is misused, the way the Japanese see the world and the present generation’s communication gap.
Abstract: The Ballast Water Convention requires less than 5% of the world tonnage for ratification. Consequently, ships will have to comply with the requirements. Compliance evaluation and enforcement will become mandatory. Ship owners have to invest in treatment systems and shipboard personnel have to operate them and ensure compliance. The monitoring and enforcement will be the responsibilities of the Administrations. Herein, a review of the current status of the Ballast Water Management and the issues faced by these are projected. Issues range from efficacy and economics of the treatment systems to sampling and testing. Health issues of chemical systems, paucity of data for decision support etc., are other issues. It is emphasized that management of ballast water must be extended to ashore and sustainable solutions must be researched upon. An exemplar treatment system based on ship’s waste heat is also suggested.
Abstract: In this paper, the design of a coaxial feed single layer rectangular microstrip patch antenna for three different wireless communication band applications is presented. The proposed antenna is designed by using substrate Roger RT/duroid 5880 having permittivity of about 2.2 and tangent loss of 0.0009. The characteristics of the substrate are designed and to evaluate the performance of modeled antenna using HFSS v.11 EM simulator, from Ansoft. The proposed antenna has small in size and operates at 2.25GHz, 3.76GHz and 5.23GHz suitable for mobile satellite service (MSS) network, WiMAX and WLAN applications. The dimension of the patch and slots are optimized to obtain these desired functional frequency ranges. The simulation results with frequency response, radiation pattern and return loss, VSWR, Input Impedance are presented with appropriate table and graph.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: Cloud virtualization technologies are becoming more
and more prevalent, cloud users usually encounter the problem of how
to access to the virtualized remote desktops easily over the web
without requiring the installation of special clients. To resolve this
issue, we took advantage of the HTML5 technology and developed
web-based remote desktop. It permits users to access the terminal
which running in our cloud platform from anywhere. We implemented
a sketch of web interface following the cloud computing concept that
seeks to enable collaboration and communication among users for
high performance computing. Given the development of remote
desktop virtualization, it allows to shift the user’s desktop from the
traditional PC environment to the cloud platform, which is stored on a
remote virtual machine rather than locally. This proposed effort has
the potential to positively provide an efficient, resilience and elastic
environment for online cloud service. This is also made possible by the
low administrative costs as well as relatively inexpensive end-user
terminals and reduced energy expenses.
Abstract: The acidity (citric acid) is the one of chemical content that can be refer to the internal quality and it’s a maturity index of tomato, The titratable acidity (%TA) can be predicted by a non-destructive method prediction by using the transmittance short wavelength (SW-NIR) spectroscopy in the wavelength range between 665-955 nm. The set of 167 tomato samples divided into groups of 117 tomatoes sample for training set and 50 tomatoes sample for test set were used to establish the calibration model to predict and measure %TA by partial least squares regression (PLSR) technique. The spectra were pretreated with MSC pretreatment and it gave the optimal result for calibration model as (R = 0.92, RMSEC = 0.03%) and this model obtained high accuracy result to use for %TA prediction in test set as (R = 0.81, RMSEP = 0.05%). From the result of prediction in test set shown that the transmittance SW-NIR spectroscopy technique can be used for a non-destructive method for %TA prediction of tomato.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: Although several factors that affect learning to
program have been identified over the years, there continues to be no
indication of any consensus in understanding why some students learn
to program easily and quickly while others have difficulty. Seldom
have researchers considered the problem of how to help the students
enhance the programming learning outcome. The research had been
conducted at a high school in Taiwan. Students participating in the
study consist of 330 tenth grade students enrolled in the Basic
Computer Concepts course with the same instructor. Two types of
training methods-instruction-oriented and exploration-oriented were
conducted. The result of this research shows that the
instruction-oriented training method has better learning performance
than exploration-oriented training method.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.