Abstract: Utilisation of biomass feedstock for biochar has received increasing attention because of their potential for carbon sequestration and soil amendment. The aim of this study is to investigate the characteristics of rubber wood as a biomass feedstock for biochar via slow pyrolysis process. This was achieved by using proximate, ultimate, and thermogravimetric analysis (TGA) as well as heating value, pH and lignocellulosic determination. Rubber wood contains 4.13 mf wt.% moisture, 86.30 mf wt.% volatile matter, 0.60 mf wt.% ash content, and 13.10 mf wt.% fixed carbon. The ultimate analysis shows that rubber wood consists of 44.33 mf wt.% carbon, 6.26 mf wt.% hydrogen, 19.31 mf wt.% nitrogen, 0.31 mf wt.% sulphur, and 29.79 mf wt.% oxygen. The higher heating value of rubber wood is 22.5 MJ/kg, and its lower heating value is 21.2 MJ/kg. At 27 °C, the pH value of rubber wood is 6.83 which is acidic. The lignocellulosic analysis revealed that rubber wood composition consists of 2.63 mf wt.% lignin, 20.13 mf wt.% cellulose, and 65.04 mf wt.% hemicellulose. The volatile matter to fixed carbon ratio is 6.58. This led to a biochar yield of 25.14 wt.% at 500 °C. Rubber wood is an environmental friendly feedstock due to its low sulphur content. Rubber wood therefore is a suitable and a potential feedstock for biochar production via slow pyrolysis.
Abstract: The first objective of this study is to investigate the suitability of coconut frond (CF) and coconut husk (CH) as feedstocks using a laboratory-scale slow pyrolysis experimental setup. The second objective is to investigate the effect of pyrolysis temperature on the biochar yield. The properties of CF and CH feedstocks were compared. The properties of the CF and CH feedstocks were investigated using proximate and elemental analysis, lignocellulosic determination, and also thermogravimetric analysis (TGA). The CF and CH feedstocks were pyrolysed at 300, 400, 500, 600 and 700 °C for 2 hours at 10 °C/min heating rate. The proximate analysis showed that CF feedstock has 89.96 mf wt% volatile matter, 4.67 mf wt% ash content and 5.37 mf wt% fixed carbon. The lignocelluloses analysis showed that CF feedstock contained 21.46% lignin, 39.05% cellulose and 22.49% hemicelluloses. The CH feedstock contained 84.13 mf wt% volatile matter, 0.33 mf wt% ash content, 15.54 mf wt% fixed carbon, 28.22% lignin, 33.61% cellulose and 22.03% hemicelluloses. Carbon and oxygen are the major component of the CF and CH feedstock compositions. Both of CF and CH feedstocks contained very low percentage of sulfur, 0.77% and 0.33%, respectively. TGA analysis indicated that coconut wastes are easily degraded. It may be due to their high volatile content. Between the temperature ranges of 300 and 800 °C, the TGA curves showed that the weight percentage of CF feedstock is lower than CH feedstock by 0.62%-5.88%. From the D TGA curves, most of the weight loss occurred between 210 and 400 °C for both feedstocks. The maximum weight loss for both CF and CH are 0.0074 wt%/min and 0.0061 wt%/min, respectively, which occurred at 324.5 °C. The yield percentage of both CF and CH biochars decreased significantly as the pyrolysis temperature was increased. For CF biochar, the yield decreased from 49.40 wt% to 28.12 wt% as the temperature increased from 300 to 700 °C. The yield for CH biochars also decreased from 52.18 wt% to 28.72 wt%. The findings of this study indicated that both CF and CH are suitable feedstock for slow pyrolysis of biochar.
Abstract: Superabsorbent polymers (SAPs) or hydrogels with three-dimensional hydrophilic network structure are high-performance water absorbent and retention materials. The in situ synthesis of metal nanoparticles within polymeric network as antibacterial agents for bio-applications is an approach that takes advantage of the existing free-space into networks, which not only acts as a template for nucleation of nanoparticles, but also provides long term stability and reduces their toxicity by delaying their oxidation and release. In this work, SAP/nanosilver nanocomposites were successfully developed by a unique green process at room temperature, which involves in situ formation of silver nanoparticles (AgNPs) within hydrogels as a template. The aim of this study is to investigate whether these AgNPs-loaded hydrogels are potential candidates for antimicrobial applications. Firstly, the superabsorbents were prepared through radical copolymerization via grafting and crosslinking of acrylamide (AAm) onto chitosan backbone (Cs) using potassium persulfate as initiator and N,N’-methylenebisacrylamide as the crosslinker. Then, they were hydrolyzed to achieve superabsorbents with ampholytic properties and uppermost swelling capacity. Lastly, the AgNPs were biosynthesized and entrapped into hydrogels through a simple, eco-friendly and cost-effective method using aqueous silver nitrate as a silver precursor and curcuma longa tuber-powder extracts as both reducing and stabilizing agent. The formed superabsorbents nanocomposites (Cs-g-PAAm)/AgNPs were characterized by X-ray Diffraction (XRD), UV-visible Spectroscopy, Attenuated Total reflectance Fourier Transform Infrared Spectroscopy (ATR-FTIR), Inductively Coupled Plasma (ICP), and Thermogravimetric Analysis (TGA). Microscopic surface structure analyzed by Transmission Electron Microscopy (TEM) has showed spherical shapes of AgNPs with size in the range of 3-15 nm. The extent of nanosilver loading was decreased by increasing Cs content into network. The silver-loaded hydrogel was thermally more stable than the unloaded dry hydrogel counterpart. The swelling equilibrium degree (Q) and centrifuge retention capacity (CRC) in deionized water were affected by both contents of Cs and the entrapped AgNPs. The nanosilver-embedded hydrogels exhibited antibacterial activity against Escherichia coli and Staphylococcus aureus bacteria. These comprehensive results suggest that the elaborated AgNPs-loaded nanomaterials could be used to produce valuable wound dressing.
Abstract: In this paper, a simple chemical precipitation route for the preparation of titanium dioxide nanoparticles, synthesized by using titanium tetra isopropoxide as a precursor and polyvinyl pyrrolidone (PVP) as a capping agent, is reported. The Differential Scanning Calorimetry (DSC) and Thermo Gravimetric Analysis (TGA) of the samples were recorded and the phase transformation temperature of titanium hydroxide, Ti(OH)4 to titanium oxide, TiO2 was investigated. The as-prepared Ti(OH)4 precipitate was annealed at 800°C to obtain TiO2 nanoparticles. The thermal, structural, morphological and textural characterizations of the TiO2 nanoparticle samples were carried out by different techniques such as DSC-TGA, X-Ray Diffraction (XRD), Fourier Transform Infra-Red spectroscopy (FTIR), Micro Raman spectroscopy, UV-Visible absorption spectroscopy (UV-Vis), Photoluminescence spectroscopy (PL) and Field Effect Scanning Electron Microscopy (FESEM) techniques. The as-prepared precipitate was characterized using DSC-TGA and confirmed the mass loss of around 30%. XRD results exhibited no diffraction peaks attributable to anatase phase, for the reaction products, after the solvent removal. The results indicate that the product is purely rutile. The vibrational frequencies of two main absorption bands of prepared samples are discussed from the results of the FTIR analysis. The formation of nanosphere of diameter of the order of 10 nm, has been confirmed by FESEM. The optical band gap was found by using UV-Visible spectrum. From photoluminescence spectra, a strong emission was observed. The obtained results suggest that this method provides a simple, efficient and versatile technique for preparing TiO2 nanoparticles and it has the potential to be applied to other systems for photocatalytic activity.
Abstract: This work involves the degradation of plastic waste in the presence of three different nanocatalysts. A thin film of LLDPE was formed with all three nanocatalysts separately in the solvent. Thermo Gravimetric Analysis (TGA) and Differential Scanning Calorimetric (DSC) analysis of polymers suggest that the presence of these catalysts lowers the degradation temperature and the change mechanism of degradation. Gas chromatographic analysis was carried out for two films. In gas chromatography (GC) analysis, it was found that degradation of pure polymer produces only 32% C3/C4 hydrocarbons and 67.6% C5/C9 hydrocarbons. In the presence of these catalysts, more than 80% of polymer by weight was converted into either liquid or gaseous hydrocarbons. Change in the mechanism of degradation of polymer was observed therefore more C3/C4 hydrocarbons along with valuable feedstock are produced. Adjustment of dose of nanocatalyst, use of nano-admixtures and recycling of catalyst can make this catalytic feedstock recycling method a good tool to get sustainable environment. The obtained products can be utilized as fuel or can be transformed into other useful products. In accordance with the principles of sustainable development, chemical recycling i.e. tertiary recycling of polymers along with the reuse (zero order recycling) of plastics can be the most appropriate and promising method in this direction. The tertiary recycling is attracting much attention from the viewpoint of the energy resource.
Abstract: This paper discusses the importance of having a good initial characterization of soil samples when thermal desorption has to be applied to polluted soils for the removal of contaminants. Particular attention has to be devoted on the desorption kinetics of the samples to identify the gases evolved during the heating, and contaminant degradation pathways. In this study, two samples coming from different points of the same contaminated site were considered. The samples are much different from each other. Moreover, the presence of high initial quantity of heavy hydrocarbons strongly affected the performance of thermal desorption, resulting in formation of dangerous intermediates. Analytical techniques such TGA (Thermogravimetric Analysis), DSC (Differential Scanning Calorimetry) and GC-MS (Gas Chromatography-Mass) provided a good support to give correct indication for field application.
Abstract: We have aimed to produce a self-cleaning transparent
polymer coating with polyurethane (PU) matrix as the latter is highly
solvent, chemical and weather resistant having good mechanical
properties. Nano-silica modified by 1H, 1H, 2H, 2Hperflurooctyltriethoxysilane
was incorporated into the PU matrix for
attaining self-cleaning ability through hydrophobicity. The
modification was confirmed by particle size analysis and scanning
electron microscopy (SEM). Thermo-gravimetric (TGA) studies were
carried to ascertain the grafting of silane onto the silica. Several
coating formulations were prepared by varying the silica loading
content and compared to a commercial equivalent. The effect of
dispersion and the morphology of the coated films were assessed by
SEM analysis. All coating standardized tests like solvent resistance,
adhesion, flexibility, acid, alkali, gloss etc. have been performed as
per ASTM standards. Water contact angle studies were conducted to
analyze the hydrophobic character of the coating. In addition, the
coatings were also subjected to salt spray and accelerated weather
testing to analyze the durability of the coating.
Abstract: The effect of carbon nanofibers (CNFs) on the
electrical properties of Poly(vinylidene fluoride-hexafluoropropylene)
(P(VdF-HFP)) based gel polymer electrolytes has been investigated
in the present work. The length and diameter ranges of CNFs used in
the present work are 5-50 μm and 200-600 nm respectively. The
nanocomposite gel polymer electrolytes have been synthesized by
solution casting technique with varying CNFs content in terms of
weight percentage. Electrochemical impedance analysis demonstrates
that the reinforcement of carbon nanofibers significantly enhances the
ionic conductivity of the polymer electrolyte. The decrease of
crystallinity of P(VdF-HFP) due the addition of CNFs has been
confirmed by X-ray diffraction (XRD). The interaction of CNFs with
various constituents of nanocomposite gel polymer electrolytes has
been assessed by Fourier Transform Infrared (FTIR) spectroscopy.
Moreover CNFs added gel polymer electrolytes offer superior
thermal stability as compared to that of CNFs free electrolytes as
confirmed by Thermogravimetric analysis (TGA).
Abstract: In this research, thorium dioxide mesoporous
nanocrystalline powder was synthesized through the sol-gel method
using hydrated thorium nitrate and ammonium hydroxide as starting
materials and Triton X100 as surfactant. ThO2 gel was characterized
by thermogravimetric (TGA), and prepared ThO2 powder was
subjected to scanning electron microscopy (SEM), X-ray diffraction
(XRD), and Brunauer-Emett-Teller (BET) analyses studies. Detailed
analyses show that prepared powder consisted of phase with the
space group Fm3m of thoria and its crystalline size was 12.6 nm. The
thoria possesses 16.7 m2/g surface area and the pore volume and size
calculated to be 0.0423 cc/g and 1.947 nm, respectively.
Abstract: A novel chromium-free protective coating films based
on a zeolite coating was growing onto a FeCrAlloy metal using in –
situ hydrothermal method. The zeolite film was obtained using in-situ
crystallization process that is capable of coating large surfaces with
complex shape and in confined spaces has been developed. The
zeolite coating offers an advantage of a high mechanical stability and
thermal stability. The physicochemical properties were investigated
using X-ray diffraction (XRD), Electron Microscopy (SEM), Energy
Dispersive X–ray Analysis (EDX) and Thermogravimetric Analysis
(TGA). The transition from oxide-on-alloy wires to hydrothermally
synthesised uniformly zeolite coated surfaces was followed using
SEM and XRD. In addition, the robustness of the prepared coating
was confirmed by subjecting these to thermal cycling (ambient to
550oC).
Abstract: Superabsorbent polymers received much attention and
are used in many fields because of their superior characters to
traditional absorbents, e.g., sponge and cotton. So, it is very
important but challenging to prepare highly and fast-swelling
superabsorbents. A reliable, efficient and low-cost technique for
removing heavy metal ions from wastewater is the adsorption using
bio-adsorbents obtained from biological materials, such as
polysaccharides-based hydrogels superabsorbents. In this study, novel multi-functional superabsorbent composites
type semi-interpenetrating polymer networks (Semi-IPNs) were
prepared via graft polymerization of acrylamide onto chitosan
backbone in presence of gelatin, CTS-g-PAAm/Ge, using potassium
persulfate and N,N’-methylene bisacrylamide as initiator and
crosslinker, respectively. These hydrogels were also partially
hydrolyzed to achieve superabsorbents with ampholytic properties
and uppermost swelling capacity. The formation of the grafted
network was evidenced by Fourier Transform Infrared Spectroscopy
(ATR-FTIR) and Thermogravimetric Analysis (TGA). The porous
structures were observed by Scanning Electron Microscope (SEM).
From TGA analysis, it was concluded that the incorporation of the Ge
in the CTS-g-PAAm network has marginally affected its thermal
stability. The effect of gelatin content on the swelling capacities of
these superabsorbent composites was examined in various media
(distilled water, saline and pH-solutions). The water absorbency was
enhanced by adding Ge in the network, where the optimum value was
reached at 2 wt. % of Ge. Their hydrolysis has not only greatly
optimized their absorption capacity but also improved the swelling
kinetic.These materials have also showed reswelling ability. We
believe that these super-absorbing materials would be very effective
for the adsorption of harmful metal ions from wastewater.
Abstract: A three-dimensional numerical model of
thermoelectric generator (TEG) modules attached to a large chimney
plate is proposed and solved numerically using a control volume based
finite difference formulation. The TEG module consists of a
thermoelectric generator, an elliptical pin-fin heat sink, and a cold
plate for water cooling. In the chimney, the temperature of flue gases is
450-650K. Although the TEG hot-side temperature and thus the
electric power output can be increased by inserting an elliptical pin-fin
heat sink into the chimney tunnel to increase the heat transfer area, the
pin fin heat sink would cause extra pumping power at the same time.
The main purpose of this study is to analyze the effects of geometrical
parameters on the electric power output and chimney pressure drop
characteristics. The effects of different operating conditions, including
various inlet velocities (Vin= 1, 3, 5 m/s), inlet temperatures (Tgas = 450,
550, 650K) and different fin height (0 to 150 mm) are discussed in
detail. The predicted numerical data for the power vs. current (P-I)
curve are in good agreement (within 11%) with the experimental data.
Abstract: Catalytic combustion of methane is imperative due to
stability of methane at low temperature. Methane (CH4), therefore,
remains unconverted in vehicle exhausts thereby causing greenhouse
gas GHG emission problem. In this study, heterogeneous catalysts of
palladium with bio-char (2 wt% Pd/Bc) and Al2O3 (2wt% Pd/ Al2O3)
supports were prepared by incipient wetness impregnation and then
subsequently tested for catalytic combustion of CH4. Support-porous
heterogeneous catalytic combustion (HCC) material were selected
based on factors such as surface area, porosity, thermal stability,
thermal conductivity, reactivity with reactants or products, chemical
stability, catalytic activity, and catalyst life. Sustainable and
renewable support-material of bio-mass char derived from palm shell
waste material was compared with those from the conventional
support-porous materials. Kinetic rate of reaction was determined for
combustion of methane on Palladium (Pd) based catalyst with Al2O3
support and bio-char (Bc). Material characterization was done using
TGA, SEM, and BET surface area. The performance test was
accomplished using tubular quartz reactor with gas mixture ratio of
3% methane and 97% air. The methane porous-HCC conversion was
carried out using online gas analyzer connected to the reactor that
performed porous-HCC. BET surface area for prepared 2 wt% Pd/Bc
is smaller than prepared 2wt% Pd/ Al2O3 due to its low porosity
between particles. The order of catalyst activity based on kinetic rate
on reaction of catalysts in low temperature was 2wt%
Pd/Bc>calcined 2wt% Pd/ Al2O3> 2wt% Pd/ Al2O3>calcined 2wt%
Pd/Bc. Hence agro waste material can successfully be utilized as an
inexpensive catalyst support material for enhanced CH4 catalytic
combustion.
Abstract: Complexation of anthocyanins to mimic natural
copigmentation process was investigated. Cyanidin-rich extracts from
Zea mays L. ceritina Kulesh. and delphinidin-rich extracts from
Clitoria ternatea L. were used to form 4 anthocyanin complexes,
AC1, AC2, AC3 and AC4, in the presence of several polyphenols and
a trace metal. Characterizations of the ACs were conducted by UV,
FTIR, DSC/TGA and morphological observations. Bathochromic
shifts of the UV spectra of 4 formulas of ACs were observed at peak
wavelengths of about 510-620 nm by 10 nm suggesting complex
formation. FTIR spectra of the ACs indicate shifts of peaks from
1,733 cm-1 to 1,696 cm-1 indicating interactions and a decrease in the
peak areas within the wavenumber of 3,400-3,500 cm-1 indicating
changes in hydrogen bonding. Thermal analysis of all of the ACs
suggests increases in melting temperature after complexation. AC
with the highest melting temperature was morphologically observed
by SEM and TEM to be crystal-like particles within a range of 50 to
200 nm. Particle size analysis of the AC by laser diffraction gave a
range of 50-600 nm, indicating aggregation. This AC was shown to
have no cytotoxic effect on cultured HGEPp0.5 and HGF (all p>
0.05) by MTT. Therefore, complexation of anthocyanins was simple
and self-assembly process, potentially resulting in nanosized particles
of anthocyanin complex.
Abstract: PVC foam-fly ash composites (PVC-FA) are
characterized for their structural, morphological, mechanical and
thermal properties. The tensile strength of the composites increased
modestly with higher fly ash loading, while there was a significant
increase in the elastic modulus for the same composites. On the other
hand, a decrease in elongation at UTS was observed upon increasing
fly ash content due to increased rigidity of the composites. Similarly,
the flexural modulus increased as the fly ash loading increased,
where the composites containing 25 phr fly ash showed the highest
flexural strength. Thermal properties of PVC-fly ash composites were
determined by Thermo Gravimetric Analysis (TGA). The
microstructural properties were studied by Scanning Electron
Microscopy (SEM). SEM results confirm that fly ash particles were
mechanically interlocked in PVC matrix with good interfacial
interaction with the matrix. Particle agglomeration and debonding
was observed in samples containing higher amounts of fly ash.
Abstract: This paper illustrates the effect of nano Magnesium
Hydroxide (MH) loading on the thermal properties of Low Density
Polyethylene (LDPE)/Poly (ethylene-co vinyl acetate) (EVA) nano
composite. Thermal studies were conducted, as it understanding is
vital for preliminary development of new polymeric systems.
Thermal analysis of nanocomposite was conducted using thermo
gravimetric analysis (TGA), and differential scanning calorimetry
(DSC). Major finding of TGA indicated two main stages of
degradation process found at (350 ± 25oC) and (480 ± 25oC)
respectively. Nano metal filler expressed better fire resistance as it
stand over high degree of temperature. Furthermore, DSC analysis
provided a stable glass temperature around 51 (±1oC) and captured
double melting point at 84 (±2oC) and 108 (±2oC). This binary
melting point reflects the modification of nano filler to the polymer
matrix forming melting crystals of folded and extended chain. The
percent crystallinity of the samples grew vividly with increasing filler
content. Overall, increasing the filler loading improved the
degradation temperature and weight loss evidently and a better
process and phase stability was captured in DSC.
Abstract: The discarded clam shell waste, fossil and edible oil
as biolubricant feedstocks create environmental impacts and food
chain dilemma, thus this work aims to circumvent these issues by
using activated saltwater clam shell waste (SCSW) as solid catalyst
for conversion of Jatropha curcas oil as non-edible sources to ester
biolubricant. The characterization of solid catalyst was done by
Differential Thermal Analysis-Thermo Gravimetric Analysis (DTATGA),
X-Ray Fluorescence (XRF), X-Ray Diffraction (XRD),
Brunauer-Emmett-Teller (BET), Field Emission Scanning Electron
Microscopy (FESEM) and Fourier Transformed Infrared
Spectroscopy (FTIR) analysis. The calcined catalyst was used in the
transesterification of Jatropha oil to methyl ester as the first step, and
the second stage was involved the reaction of Jatropha methyl ester
(JME) with trimethylolpropane (TMP) based on the various process
parameters. The formated biolubricant was analyzed using the
capillary column (DB-5HT) equipped Gas Chromatography (GC).
The conversion results of Jatropha oil to ester biolubricant can be
found nearly 96.66%, and the maximum distribution composition
mainly contains 72.3% of triester (TE).
Abstract: The assessment of the risk posed by a borrower to a
lender is one of the common problems that financial institutions have
to deal with. Consumers vying for a mortgage are generally
compared to each other by the use of a number called the Credit
Score, which is generated by applying a mathematical algorithm to
information in the applicant’s credit report. The higher the credit
score, the lower the risk posed by the candidate, and the better he is
to be taken on by the lender. The objective of the present work is to
use fuzzy logic and linguistic rules to create a model that generates
Credit Scores.
Abstract: Three dimensional non-Interlaced carbon fibre
reinforced silicon carbide (3-D-Cf/SiC) composites with pyrocarbon
interphase were fabricated using isothermal chemical vapor
infiltration (ICVI) combined with polymer impregnation pyrolysis
(PIP) process. Polysilazane (PSZ) is used as a preceramic polymer to
obtain silicon carbide matrix. Thermo gravimetric analysis (TGA),
Infrared spectroscopic analysis (IR) and X-ray diffraction (XRD)
analysis were carried out on PSZ pyrolysed at different temperatures
to understand the pyrolysis and obtaining the optimum pyrolysing
condition to yield β-SiC phase. The density of the composites was
1.94 g cm-3 after the 3-D carbon preform was SiC infiltrated for 280 h
with one intermediate polysilazane pre-ceramic PIP process.
Mechanical properties of the composite materials were investigated
under tensile, flexural, shear and impact loading. The values of
tensile strength were 200 MPa at room temperature (RT) and 195
MPa at 500°C in air. The average RT flexural strength was 243 MPa.
The lower flexural strength of these composites is because of the
porosity. The fracture toughness obtained from single edge notched
beam (SENB) technique was 39 MPa.m1/2. The work of fracture
obtained from the load-displacement curve of SENB test was 22.8
kJ.m-2. The composites exhibited excellent impact resistance and the
dynamic fracture toughness of 44.8 kJ.m-2 is achieved as determined
from instrumented Charpy impact test. The shear strength of the
composite was 93 MPa, which is significantly higher compared 2-D
Cf/SiC composites. Microstructure evaluation of fracture surfaces
revealed the signatures of fracture processes and showed good
support for the higher toughness obtained.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.