Abstract: PLA emerged as a promising polymer because of its
property as a compostable, biodegradable thermoplastic made from
renewable sources. PLA can be polymerized from monomers
(Lactide or Lactic acid) obtained by fermentation processes from
renewable sources such as corn starch or sugarcane. For PLA
synthesis, ring opening polymerization (ROP) of Lactide monomer is
one of the preferred methods. In the literature, the technique mainly
developed for ROP of PLA is based on metal/bimetallic catalyst (Sn,
Zn and Al) or other organic catalysts in suitable solvent. However,
the PLA synthesized using such catalysts may contain trace elements
of the catalyst which may cause toxicity. This work estimated the
usefulness and drawbacks of using different catalysts as well as effect
of alternative energies and future aspects for PLA production.
Abstract: Polysulfone (PSU) is a specialty engineering polymer
having various industrial applications. PSU is especially used in
waste water treatment membranes due to its good mechanical
properties, structural and chemical stability. But it is a hydrophobic
material and therefore its surface aim to pollute easily. In order to
resolve this problem and extend the properties of membrane, PSU
surface is rendered hydrophilic by addition of the sepiolite
nanofibers. Sepiolite is one of the natural clays, which is a hydrate
magnesium silicate fiber, also one of the well known layered clays of
the montmorillonites where has several unique channels and pores
within. It has also moisture durability, strength and low price.
Sepiolite channels give great capacity of absorption and good surface
properties. In this study, nanocomposites of commercial PSU and
Sepiolite were prepared by solvent mixing method. Different organic
solvents and their mixtures were used. Rheological characteristics of
PSU-Sepiolite solvent mixtures were analyzed, the solubility of
nanocomposite content in those mixtures were studied.
Abstract: In view of a possible application in optical data
storage devices, diffraction grating efficiency of an organic dye, Acid
Fuchsin doped in PMMA matrix was studied under excitation with
CW diode pumped Nd: YAG laser at 532 nm. The open aperture Zscan
of dye doped polymer displayed saturable absorption and the
closed aperture Z-scan of the samples exhibited negative
nonlinearity. The diffraction efficiency of the grating is the ratio of
the intensity of the first order diffracted power to the incident read
beam power. The dye doped polymer films were found to be good
media for recording. It is observed that the formation of gratings
strongly depend on the concentration of dye in the polymer film, the
intensity ratios of the writing beams and the angle between the
writing beams. It has been found that efficient writing can be made at
an angle of 20o and when the intensity ratio of the writing beams is
unity.
Abstract: In this paper, extract of papaya leaves are used as a
natural dye and combined by variations of solvent concentration
applied on DSSC (Dye-Sensitized Solar Cell). Indonesian geographic
located on the equator line occasions the magnitude of the potential
to develop organic solar cells made from extracts of chlorophyll as a
substitute for inorganic materials or synthetic dye on DSSC material.
Dye serves as absorbing photons which are then converted into
electrical energy. A conductive coated glass layer called TCO
(Transparent Conductive Oxide) is used as a substrate of electrode.
TiO2 nanoparticles as binding dye molecules, redox couple iodide/
tri-iodide as the electrolyte and carbon as the counter electrode in the
DSSC are used. TiO2 nanoparticles, organic dyes, electrolytes, and
counter electrode are arranged and combined with the layered
structure of the photo-catalyst absorption layer. Dye absorption
measurements using a spectrophotometer at 400-800 nm light
spectrum produces a total amount of chlorophyll 80.076 mg/l. The
test cell at 7 watt LED light with 5000 lux luminescence was
obtained Voc and Isc of 235.5 mV and 14 μA, respectively.
Abstract: The objective of this study was to determine effect of
dietary essential oil (EO) compounds, which contained
cinnamaldehyde, eugenol, peppermint, coriander, cumin, lemongrass,
and an organic carrier on feed intake, milk composition, and rumen
fermentation of dairy cows during heat exposure. Thirty-two Holstein
cows (days in milk= 60 ± 5) were assigned to one of two treatment
groups: a Control and EO fed. The experiment lasted 28 days. Dry
matter intake (DMI) was measured daily while and milk production
was measured weekly. Our result showed that DMI and milk yield
was decreased (P < 0.01) in control cows relative to EO cows.
Furthermore, supplementation with EO was associated with a
decrease in the molar proportion of propionate (P < 0.05) and
increase (P < 0.05) in acetate to propionate ratio. In conclusion, EO
supplementations in diets can be useful nutritional modification to
alleviate for the decrease DMI and milk production during heat
exposure in lactating dairy cows.
Abstract: This review summarizes the potential of starch
agroindustrial residues as substrate for biohydrogen production.
Types of potential starch agroindustrial residues, recent developments
and bio-processing conditions for biohydrogen production will be
discussed. Biohydrogen is a clean energy source with great potential
to be an alternative fuel, because it releases energy explosively in
heat engines or generates electricity in fuel cells producing water as
only by-product. Anaerobic hydrogen fermentation or dark
fermentation seems to be more favorable, since hydrogen is yielded
at high rates and various organic waste enriched with carbohydrates
as substrate result in low cost for hydrogen production. Abundant
biomass from various industries could be source for biohydrogen
production where combination of waste treatment and energy
production would be an advantage. Carbohydrate-rich nitrogendeficient
solid wastes such as starch residues can be used for
hydrogen production by using suitable bioprocess technologies.
Alternatively, converting biomass into gaseous fuels, such as
biohydrogen is possibly the most efficient way to use these
agroindustrial residues.
Abstract: The purpose of this research is to study of consumer
perception and understanding consumer buying behavior that related
between satisfied and factors affecting the purchasing. Methodology
can be classified between qualitative and quantitative approaches for
the qualitative research were interviews from middlemen who bought
organic vegetables, and middlemen related to production and
marketing system. A questionnaire was utilized as a tool to collect
data. Statistics utilized in this research included frequency,
percentage, mean, standard deviation, and multiple regression
analysis. The result show the reason to decision buying motives is
Fresh products of organic vegetables is the most significant factor on
individuals’ income, with a b of –.143, t = –2.470, the price of
organic vegetables is the most significant factor on individuals’
income, with a b of .176, t = 2.561, p value = .011. The results show
that most people with higher income think about the organic products
are expensive and have negative attitudes towards organic vegetable
as individuals with low and medium income level. Therefore,
household income had a significant influence on the purchasing
decision.
Abstract: With demand for primary energy continuously
growing, search for renewable and efficient energy sources has been
high on agenda of our society. One of the most promising energy
sources is biogas technology. Residues coming from dairy industry
and milk processing could be used in biogas production; however,
low efficiency and high cost impede wide application of such
technology. One of the main problems is management and conversion
of organic residues through the anaerobic digestion process which is
characterized by acidic environment due to the low whey pH (
Abstract: The mineral bioflotation represents a viable
alternative for the evaluation of new processes benefit alternative.
The adsorption bacteria on minerals surfaces will depend mainly on
the type of the microorganism as well as of the studied mineral
surface. In the current study, adhesion of S. carnosus on coal was
studied. Several methods were used as: DRX, Fourier Transform
Infra-Red (FTIR) adhesion isotherms and kinetic. The main goal is to
recovery of organic matter by the microflotation process on coal
particles with biological reagent (S. carnosus). Adhesion tests
revealed that adhesion took place after of 8 h at pH 9. The results
suggest that the adhesion of bacteria to solid substrates can be
considered an abiotic physicochemical process that is consequently
governed by bacterial surface properties such as their specific surface
area, hydrophobicity and surface functionalities. The greatest coal
fine flotability was of 75%, after 5 min of flotation.
Abstract: The paper presents the results of clusterization by
Kohonen self-organizing maps (SOM) applied for analysis of array of
Raman spectra of multi-component solutions of inorganic salts, for
determination of types of salts present in the solution. It is
demonstrated that use of SOM is a promising method for solution of
clusterization and classification problems in spectroscopy of multicomponent
objects, as attributing a pattern to some cluster may be
used for recognition of component composition of the object.
Abstract: In this study, a comparative analysis of the approaches
associated with the use of neural network algorithms for effective
solution of a complex inverse problem – the problem of identifying
and determining the individual concentrations of inorganic salts in
multicomponent aqueous solutions by the spectra of Raman
scattering of light – is performed. It is shown that application of
artificial neural networks provides the average accuracy of
determination of concentration of each salt no worse than 0.025 M.
The results of comparative analysis of input data compression
methods are presented. It is demonstrated that use of uniform
aggregation of input features allows decreasing the error of
determination of individual concentrations of components by 16-18%
on the average.
Abstract: Biological conversion of biomass to methane has
received increasing attention in recent years. Grasses have been
explored for their potential anaerobic digestion to methane. In this
review, extensive literature data have been tabulated and classified.
The influences of several parameters on the potential of these
feedstocks to produce methane are presented. Lignocellulosic
biomass represents a mostly unused source for biogas and ethanol
production. Many factors, including lignin content, crystallinity of
cellulose, and particle size, limit the digestibility of the hemicellulose
and cellulose present in the lignocellulosic biomass. Pretreatments
have used to improve the digestibility of the lignocellulosic biomass.
Each pretreatment has its own effects on cellulose, hemicellulose and
lignin, the three main components of lignocellulosic biomass. Solidstate
anaerobic digestion (SS-AD) generally occurs at solid
concentrations higher than 15%. In contrast, liquid anaerobic
digestion (AD) handles feedstocks with solid concentrations between
0.5% and 15%. Animal manure, sewage sludge, and food waste are
generally treated by liquid AD, while organic fractions of municipal
solid waste (OFMSW) and lignocellulosic biomass such as crop
residues and energy crops can be processed through SS-AD. An
increase in operating temperature can improve both the biogas yield
and the production efficiency, other practices such as using AD
digestate or leachate as an inoculant or decreasing the solid content
may increase biogas yield but have negative impact on production
efficiency. Focus is placed on substrate pretreatment in anaerobic
digestion (AD) as a means of increasing biogas yields using today’s
diversified substrate sources.
Abstract: A methodology is proposed for estimating the optical
attenuation and proportional depth variation of shallow inland water.
The process is demonstrated with EO-1 Hyperion hyperspectral and
IRS-P6 LISS-3 multispectral images of Kolkata city nearby area
centered around 22º33′ N 88º26′ E. The attenuation coefficient of
water was found to change with fine resolution of wavebands and in
presence of suspended organic matter in water.
Abstract: Compost can influence soil fertility and plant health. At the same time compost can play an important role in the nitrogen cycle and it can influence leaching of mineral nitrogen from soil to underground water.
This paper deals with the influence of compost addition and mineral nitrogen fertilizer on leaching of mineral nitrogen, nitrogen availability in microbial biomass and plant biomass production in the lysimetric experiment. Twenty one lysimeters were filed with topsoil and subsoil collected in the area of protection zone of underground source of drinking water - Březová nad Svitavou. The highest leaching of mineral nitrogen was detected in the variant fertilized only mineral nitrogen fertilizer (624.58 mg m-2), the lowest leaching was recorded in the variant with high addition of compost (315.51 mg m-2). On the other hand, losses of mineral nitrogen are not in connection with the losses of available form of nitrogen in microbial biomass. Because lost of mineral nitrogen was detected in variant with the least change in the availability of N in microbial biomass.
The leaching of mineral nitrogen, yields as well as the results concerning nitrogen availability from the first year of long term experiment suggest that compost can positive influence the leaching of nitrogen into underground water.
Abstract: In this study, a liquid phase microextraction by hollow fiber (HF-LPME) combined with high performance liquid chromatography-UV detector was applied to preconcentrate and determine trace levels of Cyproheptadine in human urine and plasma samples. Cyproheptadine was extracted from 10 mL alkaline aqueous solution (pH: 9.81) into an organic solvent (n-octnol) which was immobilized in the wall pores of a hollow fiber. Then was back-extracted into an acidified aqueous solution (pH: 2.59) located inside the lumen of the hollow fiber. This method is simple, efficient and cost-effective. It is based on pH gradient and differences between two aqueous phases. In order to optimize the HF-LPME some affecting parameters including the pH of donor and acceptor phases, the type of organic solvent, ionic strength, stirring rate, extraction time and temperature were studied and optimized. Under optimal conditions enrichment factor, limit of detection (LOD) and relative standard deviation (RSD(%), n=3) were up to 112, 15 μg.L−1 and 2.7, respectively.
Abstract: Each of the countries around the world has different
ways of management and many of them depend on people to
administrate their country. Thailand, for example, empowers the
sovereignty of Thai people under constitution; however, our Thai
voting system is not able to flow fast enough under the current
Political management system. The sovereignty of Thai people is
addressing this problem through representatives during current
elections, in order to set a new policy for the countries ideology to
change in the House and the Cabinet.
This is particularly important in a democracy to be developed
under our current political institution. The Organic Act on Political
Parties 2007 is the establishment we have today that is causing
confrontations within the establishment. There are many political
parties that will soon be abolished. Many political parties have
already been subsidized. This research study is to analyze the legal
problems with the political party establishment under the Organic Act
on Political Parties 2007.
This will focus on the freedom of each political establishment
compared to an effective political operation. Textbooks and academic
papers will be referenced from studies home and abroad.
The study revealed that Organic Act on Political Parties 2007 has
strict provisions on the political structure over the number of
members and the number of branches involved within political
parties system.
Such operations shall be completed within one year; but under the
existing laws the small parties are not able to participate with the
bigger parties. The cities are capable of fulfilling small political party
requirements but fail to become coalesced because the current laws
won't allow them to be united as one. It is important to allow all
independent political parties to join our current political structure.
Board members can’t help the smaller parties to become a large
organization under the existing Thai laws.
Creating a new establishment that functions efficiently throughout
all branches would be one solution to these legal problems between
all political parties. With this new operation, individual political
parties can participate with the bigger parties during elections. Until
current political institutions change their system to accommodate
public opinion, these current Thai laws will continue to be a problem
with all political parties in Thailand.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.
Abstract: The subject of this paper is the design analysis of a single well power production unit from low enthalpy geothermal resources. A complexity of the project is defined by a low temperature heat source that usually makes such projects economically disadvantageous using the conventional binary power plant approach. A proposed new compact design is numerically analyzed. This paper describes a thermodynamic analysis, a working fluid choice, downhole heat exchanger (DHE) and turbine calculation results. The unit is able to produce 321 kW of electric power from a low enthalpy underground heat source utilizing n-Pentane as a working fluid. A geo-pressured reservoir located in Vermilion Parish, Louisiana, USA is selected as a prototype for the field application. With a brine temperature of 126 , the optimal length of DHE is determined as 304.8 m (1000ft). All units (pipes, turbine, and pumps) are chosen from commercially available parts to bring this project closer to the industry requirements. Numerical calculations are based on petroleum industry standards. The project is sponsored by the Department of Energy of the US.