Abstract: The main purpose of this study is to assess the
sediment quality and potential ecological risk in marine sediments in
Gymea Bay located in south Sydney, Australia. A total of 32 surface
sediment samples were collected from the bay. Current track
trajectories and velocities have also been measured in the bay. The
resultant trace elements were compared with the adverse biological
effect values Effect Range Low (ERL) and Effect Range Median
(ERM) classifications. The results indicate that the average values of
chromium, arsenic, copper, zinc, and lead in surface sediments all
reveal low pollution levels and are below ERL and ERM values. The
highest concentrations of trace elements were found close to
discharge points and in the inner bay, and were linked with high
percentages of clay minerals, pyrite and organic matter, which can
play a significant role in trapping and accumulating these elements.
The lowest concentrations of trace elements were found to be on the
shoreline of the bay, which contained high percentages of sand
fractions. It is postulated that the fine particles and trace elements are
disturbed by currents and tides, then transported and deposited in
deeper areas. The current track velocities recorded in Gymea Bay had
the capability to transport fine particles and trace element pollution
within the bay. As a result, hydrodynamic measurements were able to
provide useful information and to help explain the distribution of
sedimentary particles and geochemical properties. This may lead to
knowledge transfer to other bay systems, including those in remote
areas. These activities can be conducted at a low cost, and are
therefore also transferrable to developing countries. The advent of
portable instruments to measure trace elements in the field has also
contributed to the development of these lower cost and easily applied
methodologies available for use in remote locations and low-cost
economies.
Abstract: Gastric Cancer (GC) has high morbidity and fatality
rate in various countries. It is still one of the most frequent and
deadly diseases. Gastrokine1 (GKN1) and gastrokine2 (GKN2) genes
are highly expressed in the normal stomach epithelium and play
important roles in maintaining the integrity and homeostasis of
stomach mucosal epithelial cells. In this study, 47 paired samples that
were grouped according to the types of gastric cancer and the clinical
characteristics of the patients, including gender and average of age.
They were investigated with gene expression analysis and mutation
screening by monitoring RT-PCR, SSCP and nucleotide sequencing
techniques. Both GKN1 and GKN2 genes were observed significantly
reduced found by (Wilcoxon signed rank test; p
Abstract: This paper describes the development of a DNA-based
nanobiosensor to detect the dengue virus in mosquito using
electrically active magnetic (EAM) nanoparticles as concentrator and
electrochemical transducer. The biosensor detection encompasses
two sets of oligonucleotide probes that are specific to the dengue
virus: the detector probe labeled with the EAM nanoparticles and the
biotinylated capture probe. The DNA targets are double hybridized to
the detector and the capture probes and concentrated from
nonspecific DNA fragments by applying a magnetic field.
Subsequently, the DNA sandwiched targets (EAM-detector probe–
DNA target–capture probe-biotin) are captured on streptavidin
modified screen printed carbon electrodes through the biotinylated
capture probes. Detection is achieved electrochemically by measuring
the oxidation–reduction signal of the EAM nanoparticles. Results
indicate that the biosensor is able to detect the redox signal of the
EAM nanoparticles at dengue DNA concentrations as low as 10
ng/μl.
Abstract: This study presents a kinematic positioning approach
that uses a global positioning system (GPS) buoy for precise ocean
surface monitoring. The GPS buoy data from the two experiments are
processed using an accurate, medium-range differential kinematic
technique. In each case, the data from a nearby coastal site are
collected at a high rate (1 Hz) for more than 24 hours, and
measurements are conducted in neighboring tidal stations to verify
the estimated sea surface heights. The GPS buoy kinematic
coordinates are estimated using epoch-wise pre-elimination and a
backward substitution algorithm. Test results show that centimeterlevel
accuracy can be successfully achieved in determining sea
surface height using the proposed technique. The centimeter-level
agreement between the two methods also suggests the possibility of
using this inexpensive and more flexible GPS buoy equipment to
enhance (or even replace) current tidal gauge stations.
Abstract: The purpose of the study is to find out relation of
moral massage between the authority and globalization in proverb.
Proverb is one of the many forms of cultural identity of the
Indonesian/Malay people filled with moral values. The values
contained within those proverbs are beneficial not only to the society,
but also to those who held power amidst on this era of globalization.
The method being used is qualitative research through content
analysis which is done by describing and uncovering the forms and
meanings of proverbs used within Indonesia Minangkabau society.
Sources for this study’s data were extracted from a Minangkabau
native speaker in the sub district of Tanah Abang, Jakarta. Said
sources were retrieved through a series of interviews with the
Minangkabau native speaker, whose speech is still adorned with
idiomatic expressions. The research findings show that there are 30
existed proverbs or idiomatic expressions in the Minangkabau
language often used by its indigenous people. The thirty data contain
moral values which are closely interwoven with the matter of power
and globalization. Analytical results show that the fourteen moral
values contained within proverbs reflect a firm connection between
rule and power in globalization; such as: responsible, brave,
togetherness and consensus, tolerance, politeness, thorough and
meticulous, honest and keeping promise, ingenious and learning,
care, self-correction, be fair, alert, arbitrary, self-awareness.
Structurally, proverbs possess an unchangeably formal construction;
symbolically, proverbs possess meanings that are clearly decided
through ethnographic communicative factors along with situational
and cultural contexts. Values contained within proverbs may be used
as a guide in social management, be it between fellow men, between
men and nature, or even between men and their Creator. Therefore,
the meanings and values contained within the morals of proverbs
could also be utilized as a counsel for those who rule and in charge of
power in order to stem the tides of globalization that had already
spread into sectoral, territorial and educational continuums.
Abstract: The disposal and the treatment of sewage sludge is an
expensive and environmentally complex problem. In this work, a
lipopeptide biosurfactant extracted from corn steep liquor was used
as ecofriendly and cost-competitive alternative for the mobilization
and bioremediation of fluorene in sewage sludge. Results have
demonstrated that this biosurfactant has the capability to mobilize
fluorene to the aqueous phase, reducing the amount of fluorene in the
sewage sludge from 484.4 mg/Kg up to 413.7 mg/Kg and 196.0
mg/Kg after 1 and 27 days respectively. Furthermore, once the
fluorene was extracted the lipopeptide biosurfactant contained in the
aqueous phase allowed the biodegradation, up to 40.5% of the initial
concentration of this polycyclic aromatic hydrocarbon.
Abstract: Several embryonic cellular mechanism including cell
cycle, growth and apoptosis are regulated by phosphatidylinositol-3-
kinase (PI3K)/Akt signaling pathway. The goal of present study is to
determine the effects of annatto (Bixa orellana)-derived δ-tocotrienol
(δ-TCT) on the regulations of PI3K/Akt genes in murine morula.
Twenty four 6-8 week old (23-25g) female balb/c mice were
randomly divided into four groups (G1-G4; n=6). Those groups were
subjected to the following treatments for 7 consecutive days: G1
(control) received tocopherol stripped corn oil, G2 was given 60
mg/kg/day of δ-TCT mixture (contains 90% delta & 10% gamma
isomers), G3 was given 60 mg/kg/day of pure δ-TCT (>98% purity)
and G4 received 60 mg/kg/day α-TOC. On Day 8, females were
superovulated with 5 IU Pregnant Mare’s Serum Gonadotropin
(PMSG) for 48 hours followed with 5 IU human Chorionic
Gonadotropin (hCG) before mated with males at the ratio of 1:1.
Females were sacrificed by cervical dislocation for embryo collection
48 hours post-coitum. About fifty morulas from each group were
used in the gene expression analyses using Affymetrix QuantiGene
Plex 2.0 Assay. Present data showed a significant increase (p
Abstract: To ensure targeting of apoferritin nanocarrier with
encapsulated doxorubicin drug, we used a peptide linker based on a
protein G with N-terminus affinity towards Fc region of antibodies.
To connect the peptide to the surface of apoferritin, the C-terminus of
peptide was made of cysteine with affinity to gold. The surface of
apoferritin with encapsulated doxorubicin (APODOX) was coated
either with gold nanoparticles (APODOX-Nano) or gold(III) chloride
hydrate reduced with sodium borohydride (APODOX-HAu). The
reduction with sodium borohydride caused a loss of doxorubicin
fluorescent properties and probably accompanied with the loss of its
biological activity. Fluorescent properties of APODOX-Nano were
similar to the unmodified APODOX; therefore it was more suited for
the intended use. To evaluate the specificity of apoferritin modified
with antibodies, ELISA-like method was used with the surface of
microtitration plate wells coated by the antigen (goat anti-human IgG
antibodies). To these wells, the nanocarrier was applied. APODOX
without the modification showed 5× lower affinity to the antigen than
APODOX-Nano modified gold and targeting antibodies (human IgG
antibodies).
Abstract: Some plants of genus Schinus have been used in the
folk medicine as topical antiseptic, digestive, purgative, diuretic,
analgesic or antidepressant, and also for respiratory and urinary
infections. Chemical composition of essential oils of S. molle and S.
terebinthifolius had been evaluated and presented high variability
according with the part of the plant studied and with the geographic
and climatic regions. The pharmacological properties, namely
antimicrobial, anti-tumoural and anti-inflammatory activities are
conditioned by chemical composition of essential oils. Taking into
account the difficulty to infer the pharmacological properties of
Schinus essential oils without hard experimental approach, this work
will focus on the development of a decision support system, in terms
of its knowledge representation and reasoning procedures, under a
formal framework based on Logic Programming, complemented with
an approach to computing centered on Artificial Neural Networks
and the respective Degree-of-Confidence that one has on such an
occurrence.
Abstract: Purpose: The study aimed to assess the depressant or
antidepressant effects of several Nonsteroidal Anti-Inflammatory
Drugs (NSAIDs) in mice: the selective cyclooxygenase-2 (COX-2)
inhibitor meloxicam, and the non-selective COX-1 and COX-2
inhibitors lornoxicam, sodium metamizole, and ketorolac. The
current literature data regarding such effects of these agents are
scarce.
Materials and methods: The study was carried out on NMRI mice
weighing 20-35 g, kept in a standard laboratory environment. The
study was approved by the Ethics Committee of the University of
Medicine and Pharmacy „Carol Davila”, Bucharest. The study agents
were injected intraperitoneally, 10 mL/kg body weight (bw) 1 hour
before the assessment of the locomotor activity by cage testing (n=10
mice/ group) and 2 hours before the forced swimming tests (n=15).
The study agents were dissolved in normal saline (meloxicam,
sodium metamizole), ethanol 11.8% v/v in normal saline (ketorolac),
or water (lornoxicam), respectively. Negative and positive control
agents were also given (amitryptilline in the forced swimming test).
The cage floor used in the locomotor activity assessment was divided
into 20 equal 10 cm squares. The forced swimming test involved
partial immersion of the mice in cylinders (15/9cm height/diameter)
filled with water (10 cm depth at 28C), where they were left for 6
minutes. The cage endpoint used in the locomotor activity assessment
was the number of treaded squares. Four endpoints were used in the
forced swimming test (immobility latency for the entire 6 minutes,
and immobility, swimming, and climbing scores for the final 4
minutes of the swimming session), recorded by an observer that was
„blinded” to the experimental design. The statistical analysis used the
Levene test for variance homogeneity, ANOVA and post-hoc
analysis as appropriate, Tukey or Tamhane tests.
Results: No statistically significant increase or decrease in the
number of treaded squares was seen in the locomotor activity
assessment of any mice group. In the forced swimming test,
amitryptilline showed an antidepressant effect in each experiment, at
the 10 mg/kg bw dosage. Sodium metamizole was depressant at 100
mg/kg bw (increased the immobility score, p=0.049, Tamhane test),
but not in lower dosages as well (25 and 50 mg/kg bw). Ketorolac
showed an antidepressant effect at the intermediate dosage of 5
mg/kg bw, but not so in the dosages of 2.5 and 10 mg/kg bw,
respectively (increased the swimming score, p=0.012, Tamhane test).
Meloxicam and lornoxicam did not alter the forced swimming
endpoints at any dosage level.
Discussion: 1) Certain NSAIDs caused changes in the forced
swimming patterns without interfering with locomotion. 2) Sodium
metamizole showed a depressant effect, whereas ketorolac proved
antidepressant. Conclusion: NSAID-induced mood changes are not
class effects of these agents and apparently are independent of the
type of inhibited cyclooxygenase (COX-1 or COX-2).
Disclosure: This paper was co-financed from the European Social
Fund, through the Sectorial Operational Programme Human Resources Development 2007-2013, project number POSDRU /159
/1.5 /S /138907 "Excellence in scientific interdisciplinary research,
doctoral and postdoctoral, in the economic, social and medical fields
-EXCELIS", coordinator The Bucharest University of Economic
Studies.
Abstract: This paper analyzes the political and economic issues
that people with disabilities face related to globalization; how people
with disabilities have been adapting globalization and surviving under
worldwide competition system. It explains that economic
globalization exacerbates inequality and deprivation of people with
disabilities. The rising tide of neo-liberal welfare policies emphasized
efficiency, downsized social expenditure for people with disabilities,
excluded people with disabilities against labor market, and shifted
them from welfare system to nothing. However, there have been
people with disabilities' political responses to globalization, which are
characterized by a global network of people with disabilities as well as
participation to global governance. Their resistance can be seen as an
attempt to tackle the problems that economic globalization has
produced. It is necessary paradigm shift of disability policy from
dependency represented by disability benefits to independency
represented by labor market policies for people with disabilities.
Abstract: In this study, we have focused our attention on
combining of molecular imprinting into nanofilms and QCM
nanosensor approaches and producing QCM nanosensor for anti-
CCP, chosen as model protein, using anti-CCP imprinted nanofilms.
The nonimprinted nanosensor was also prepared to evaluate the
selectivity of the imprinted nanosensor. Anti-CCP imprinted QCM
nanosensor was tested for real time detection of anti-CCP from
aqueous solution. The kinetic and affinity studies were determined by
using anti-CCP solutions with different concentrations. The
responses related with mass shifts (%m) and frequency shifts (%f)
were used to evaluate adsorption properties. To show the selectivity
of the anti-CCP imprinted QCM nanosensor, competitive adsorption
of anti-CCP and IgM was investigated. The results indicate that anti-
CCP imprinted QCM nanosensor has higher adsorption capabilities
for anti-CCP than for IgM, due to selective cavities in the polymer
structure.
Abstract: PLA emerged as a promising polymer because of its
property as a compostable, biodegradable thermoplastic made from
renewable sources. PLA can be polymerized from monomers
(Lactide or Lactic acid) obtained by fermentation processes from
renewable sources such as corn starch or sugarcane. For PLA
synthesis, ring opening polymerization (ROP) of Lactide monomer is
one of the preferred methods. In the literature, the technique mainly
developed for ROP of PLA is based on metal/bimetallic catalyst (Sn,
Zn and Al) or other organic catalysts in suitable solvent. However,
the PLA synthesized using such catalysts may contain trace elements
of the catalyst which may cause toxicity. This work estimated the
usefulness and drawbacks of using different catalysts as well as effect
of alternative energies and future aspects for PLA production.
Abstract: The western Tombolo of the Giens peninsula in
southern France, known as Almanarre beach, is subject to coastal
erosion. We are trying to use computer simulation in order to propose
solutions to stop this erosion. Our aim was first to determine the main
factors for this erosion and successfully apply a coupled hydrosedimentological
numerical model based on observations and
measurements that have been performed on the site for decades.
We have gathered all available information and data about waves,
winds, currents, tides, bathymetry, coastal line, and sediments
concerning the site. These have been divided into two sets: one
devoted to calibrating a numerical model using Mike 21 software, the
other to serve as a reference in order to numerically compare the
present situation to what it could be if we implemented different
types of underwater constructions.
This paper presents the first part of the study: selecting and
melting different sources into a coherent data basis, identifying the
main erosion factors, and calibrating the coupled software model
against the selected reference period.
Our results bring calibration of the numerical model with good
fitting coefficients. They also show that the winter South-Western
storm events conjugated to depressive weather conditions constitute a
major factor of erosion, mainly due to wave impact in the northern
part of the Almanarre beach. Together, current and wind impact is
shown negligible.
Abstract: Monoamine oxidase A gene (MAOA) is suggested to
be a candidate gene implicated in many neuropsychiatric disorders,
including autism spectrum disorder (ASD). This meta-analytic review
evaluates the relationship between ASD and MAOA markers such as
30 bp variable number tandem repeats in the promoter region
(uVNTR) and single nucleotide polymorphisms (SNPs) by using
findings from recently published studies. It seems that in Caucasian
males, the risk of developing ASD increase with the presence of 4-
repeat allele in the promoter region of MAOA gene whereas no
differences were found between autistic patients and controls in
Egyptian, West Bengal and Korean population. Some studies point to
the importance of specific haplotype groups of SNPs and interaction
of MAOA with others genes (e. g. FOXP2 or SRY). The results of
existing studies are insufficient and further research is needed.
Abstract: Domestic goats (Capra hircus) are extremely diverse
species and principal animal genetic resource of the developing
world. These facilitate a persistent supply of meat, milk, fibre, and
skin and are considered as important revenue generators in small
pastoral environments. This study aimed to fingerprint β-LG gene at
PCR-RFLP level in native Saudi goat breeds (Ardi, Habsi and Harri)
in an attempt to have a preliminary image of β-LG genotypic patterns
in Saudi breeds as compared to other foreign breeds such as Indian
and Egyptian. Also, the Phylogenetic analysis was done to investigate
evolutionary trends and similarities among the caprine β-LG gene
with that of the other domestic specie, viz. cow, buffalo and sheep.
Blood samples were collected from 300 animals (100 for each breed)
and genomic DNA was extracted. A fragment of the β-LG gene
(427bp) was amplified using specific primers. Subsequent digestion
with Sac II restriction endonuclease revealed two alleles (A and B)
and three different banding patterns or genotypes i.e. AA, AB and
BB. The statistical analysis showed a general trend that β-LG AA
genotype had higher milk yield than β-LG AB and β-LG BB
genotypes. Nucleotide sequencing of the selected β-LG fragments
was done and submitted to GenBank NCBI (Accession No.
KJ544248, KJ588275, KJ588276, KJ783455, KJ783456 and
KJ874959). Phylogenetic analysis on the basis of nucleotide
sequences of native Saudi goats indicated evolutional similarity with
the GenBank reference sequences of goat, Bubalus bubalis and Bos
taurus. However, the origin of sheep which is the most closely
related from the evolutionary point of view, was located some
distance away.
Abstract: A study was conducted to determine the diversity and
abundance of shorebird species habituating the mudflat area of Jeram
Beach and Remis Beach, Selangor, Peninsular Malaysia. Direct
observation technique (using binoculars and video camera) was
applied to record the presence of bird species in the sampling sites
from August 2013 until July 2014. A total of 32 species of shorebird
were recorded during both migratory and non-migratory seasons. Of
these, eleven species (48%) are migrants, six species (26%) have both
migrant and resident populations, four species (17%) are vagrants and
two species (9%) are residents. The compositions of the birds
differed significantly in all months (χ2 = 84.35, p < 0.001). There is a
significant difference in avian abundance between migratory and
non-migratory seasons (Mann-Whitney, t = 2.39, p = 0.036). The
avian abundance were differed significantly in Jeram and Remis
Beaches during migratory periods (t = 4.39, p = 0.001) but not during
non-migratory periods (t = 0.78, p = 0.456). Shorebird diversity was
also affected by tidal cycle. There is a significance difference
between high tide and low tide (Mann-Whitney, t = 78.0, p < 0.005).
Frequency of disturbance also affected the shorebird distribution
(Mann-Whitney, t = 57.0, p = 0.0134). Therefore, this study
concluded that tides and disturbances are two factors that affecting
temporal distribution of shorebird in mudflats area.
Abstract: Amyloid aggregation of polypeptides is related to a
growing number of pathologic states known as amyloid disorders. In
recent years, blocking or reversing amyloid aggregation via the use of
small compounds are considered as two useful approaches in
hampering the development of these diseases. In this research, we
have compared the ability of several manganese-salen derivatives, as
synthetic compounds, and apigenin, as a natural flavonoid, to inhibit
of hen egg-white lysozyme (HEWL) aggregation, as an in vitro
model system.
Different spectroscopic analyses such as Thioflavin T (ThT) and
Anilinonaphthalene-8-sulfonic acid (ANS) fluorescence, Congo red
(CR) absorbance along with transmission electron microscopy were
used in this work to monitor the HEWL aggregation kinetic and
inhibition. Our results demonstrated that both type of compounds
were capable to prevent the formation of lysozyme amyloid
aggregation in vitro. In addition, our data indicated that synthetic
compounds had higher activity to inhibit of the β-sheet structures
relative to natural compound. Regarding the higher antioxidant
activities of the salen derivatives, it can be concluded that in addition
to aromatic rings of each of the compounds, the potent antioxidant
properties of salen derivatives contributes to lower lysozyme fibril
accumulation.
Abstract: Soy protein is a common ingredient added to processed meats to enhance its functional characteristics. In our study, soybean products (fermented soy Natto and protein hydrolysate) containing hydrolyzed peptides and amino acids, with or without ascorbic acid were added to burger in order to improve its quality characteristics. Results showed that soy additives significantly increased moisture and protein content and reduced (P < 0.05) fat values. Ash content did not affect with Natto additive. Color tools, lightness and yellowness were higher (P
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.