Abstract: Pre-construction is essential in achieving the success of a construction project. Due to the early involvement of project participants in the construction phase, project managers are able to plan ahead and solve issues well in advance leading to the success of the project and the satisfaction of the client. This research utilizes quantitative data derived from construction management projects in order to identify the relationship between pre-construction, construction schedule, and client satisfaction. A total of 65 construction projects and 93 clients were investigated for this research in an attempt to identify (a) the relationship between pre-construction and schedule reduction, and (b) pre-construction and client loyalty. Based on the quantitative analysis, this research was able to establish a negative correlation based on 65 construction projects between pre-construction and project schedule existed. This finding represents that the more pre-construction is performed for a certain project, the overall construction schedule decreased. Then, to determine the relationship between pre-construction and client satisfaction, Net Promoter Score (NPS) of 93 clients from the 65 projects was utilized. Pre-construction and NPS was further analyzed and a positive correlation was found between the two. This infers that clients tend to be more satisfied with projects with higher ratio of pre-construction than those projects with less pre-construction.
Abstract: The proposed method for speciation, preconcentration and determination of Fe(II) and Fe(III) in pharmaceutical products was developed using of alumina-coated magnetite nanoparticles (Fe3O4/Al2O3 NPs) as solid phase extraction (SPE) sorbent in magnetic mixed hemimicell solid phase extraction (MMHSPE) technique followed by flame atomic absorption spectrometry analysis. The procedure is based on complexation of Fe(II) with 1, 10-phenanthroline (OP) as complexing reagent for Fe(II) that immobilized on the modified Fe3O4/Al2O3 NPs. The extraction and concentration process for pharmaceutical sample was carried out in a single step by mixing the extraction solvent, magnetic adsorbents under ultrasonic action. Then, the adsorbents were isolated from the complicated matrix easily with an external magnetic field. Fe(III) ions determined after facility reduced to Fe(II) by added a proper reduction agent to sample solutions. Compared with traditional methods, the MMHSPE method simplified the operation procedure and reduced the analysis time. Various influencing parameters on the speciation and preconcentration of trace iron, such as pH, sample volume, amount of sorbent, type and concentration of eluent, were studied. Under the optimized operating conditions, the preconcentration factor of the modified nano magnetite for Fe(II) 167 sample was obtained. The detection limits and linear range of this method for iron were 1.0 and 9.0 - 175 ng.mL−1, respectively. Also the relative standard deviation for five replicate determinations of 30.00 ng.mL-1 Fe2+ was 2.3%.
Abstract: Despite the rapid nanotechnology progress and recognition, its potential impact in ecosystems and health of humans is still not fully known. In this paper, the study of ecotoxicological dangers of nanomaterials is presented. By chemical reduction method, silver (AgNPs) and gold (AuNPs) nanoparticles were synthesized, characterized and used in experiments to examine their impact on microorganisms (Escherichia coli, Staphylococcus aureus and Candida albicans) and terrestrial flora (Phaseolus vulgaris and Lepidium sativum). The results collected during experiments with terrestrial flora show tendentious growth stimulations caused by gold nanoparticles. In contrast to these results, silver nanoparticle solutions inhibited growth of beans and garden cress, compared to control samples. The results obtained from experiments with microorganisms show similarities with ones collected from experiments with terrestrial plants. Samples treated with AuNPs of size 13 nm showed stimulation in the growth of the colonies compared with 3,5 nm size nanoparticles.
Abstract: Reservoirs are being contaminated all around the world with point source and Non-Point Source (NPS) pollution. The most common NPS pollutants are sediments and nutrients. Krishnagiri Reservoir (KR) has been chosen for the present case study, which is located in the tropical semi-arid climatic zone of Tamil Nadu, South India. It is the main source of surface water in Krishnagiri district to meet the freshwater demands. The reservoir has lost about 40% of its water holding capacity due to sedimentation over the period of 50 years. Hence, from the research and management perspective, there is a need for a sound knowledge on the spatial and seasonal variations of KR water quality. The present study encompasses the specific objectives as (i) to investigate the longitudinal heterogeneity and seasonal variations of physicochemical parameters, nutrients and biological characteristics of KR water and (ii) to examine the extent of degradation of water quality in KR. 15 sampling points were identified by uniform stratified method and a systematic monthly sampling strategy was selected due to high dynamic nature in its hydrological characteristics. The physicochemical parameters, major ions, nutrients and Chlorophyll a (Chl a) were analysed. Trophic status of KR was classified by using Carlson's Trophic State Index (TSI). All statistical analyses were performed by using Statistical Package for Social Sciences programme, version-16.0. Spatial maps were prepared for Chl a using Arc GIS. Observations in KR pointed out that electrical conductivity and major ions are highly variable factors as it receives inflow from the catchment with different land use activities. The study of major ions in KR exhibited different trends in their values and it could be concluded that as the monsoon progresses the major ions in the water decreases or water quality stabilizes. The inflow point of KR showed comparatively higher concentration of nutrients including nitrate, soluble reactive phosphorus (SRP), total phosphors (TP), total suspended phosphorus (TSP) and total dissolved phosphorus (TDP) during monsoon seasons. This evidently showed the input of significant amount of nutrients from the catchment side through agricultural runoff. High concentration of TDP and TSP at the lacustrine zone of the reservoir during summer season evidently revealed that there was a significant release of phosphorus from the bottom sediments. Carlson’s TSI of KR ranged between 81 and 92 during northeast monsoon and summer seasons. High and permanent Cyanobacterial bloom in KR could be mainly due to the internal loading of phosphorus from the bottom sediments. According to Carlson’s TSI classification Krishnagiri reservoir was ranked in the hyper-eutrophic category. This study provides necessary basic data on the spatio-temporal variations of water quality in KR and also proves the impact of point and NPS pollution from the catchment area. High TSI warrants a greater threat for the recovery of internal P loading and hyper-eutrophic condition of KR. Several expensive internal measures for the reduction of internal loading of P were introduced by many scientists. However, the outcome of the present research suggests for the innovative algae harvesting technique for the removal of sediment nutrients.
Abstract: Meat Tenderness is one of the most important factors affecting consumers' assessment of meat quality. Variation in meat tenderness is genetically controlled and varies among breeds, and it is also influenced by environmental factors that can affect its creation during rigor mortis and postmortem. The final postmortem meat tenderization relies on the extent of proteolysis of myofibrillar proteins caused by the endogenous activity of the proteolytic calpain system. This calpain system includes different calcium-dependent cysteine proteases, and an inhibitor, calpastatin. It is widely accepted that in farm animals including chickens, the μ-calpain gene (CAPN1) is a physiological candidate gene for meat tenderness. This study aimed to identify the association of single nucleotide polymorphism (SNP) markers in the CAPN1 gene with the tenderness of chicken breast meat from two Malaysian native and commercial broiler breed crosses. Ten, five months old native chickens and ten, 42 days commercial broilers were collected from the local market and breast muscles were removed two hours after slaughter, packed separately in plastic bags and kept at -20ºC for 24 h. The tenderness phenotype for all chickens’ breast meats was determined by Warner-Bratzler Shear Force (WBSF). Thawing and cooking losses were also measured in the same breast samples before using in WBSF determination. Polymerase chain reaction (PCR) was used to identify the previously reported C7198A and G9950A SNPs in the CAPN1 gene and assess their associations with meat tenderness in the two breeds. The broiler breast meat showed lower shear force values and lower thawing loss rates than the native chickens (p
Abstract: This study presents the seismic safety evaluation of weir structure subjected to strong earthquake ground motions, as a flood defense structure in civil engineering structures. The seismic safety analysis procedure was illustrated through development of Finite Element (FE) and InFinite Element (IFE) method in ABAQUS platform. The IFE model was generated by CINPS4, 4-node linear one-way infinite model as a sold continuum infinite element in foundation areas of the weir structure and then nonlinear FE model using friction model for soil-structure interactions was applied in this study. In order to understand the complex behavior of weir structures, nonlinear time history analysis was carried out. Consequently, it was interesting to note that the compressive stress gave more vulnerability to the weir structure, in comparison to the tensile stress, during an earthquake. The stress concentration of the weir structure was shown at the connection area between the weir body and stilling basin area. The stress both tension and compression was reduced in IFE model rather than FE model of weir structures.
Abstract: Excessive vibration means increased wear, increased
repair efforts, bad product selection & quality and high energy
consumption. This may be sometimes experienced by cavitation or
suction/discharge recirculation which could occur only when net
positive suction head available NPSHA drops below the net positive
suction head required NPSHR. Cavitation can cause axial surging, if it
is excessive, will damage mechanical seals, bearings, possibly other
pump components frequently, and shorten the life of the impeller.
Efforts have been made to explain Suction Energy (SE), Specific
Speed (Ns), Suction Specific Speed (Nss), NPSHA, NPSHR & their
significance, possible reasons of cavitation /internal recirculation, its
diagnostics and remedial measures to arrest and prevent cavitation in
this paper. A case study is presented by the author highlighting that
the root cause of unwanted noise and vibration is due to cavitation,
caused by high specific speeds or inadequate net- positive suction
head available which results in damages to material surfaces of
impeller & suction bells and degradation of machine performance, its
capacity and efficiency too. Author strongly recommends revisiting
the technical specifications of CW pumps to provide sufficient NPSH
margin ratios >1.5, for future projects and Nss be limited to 8500 -
9000 for cavitation free operation.
Abstract: This study evaluated the acute toxicity and tissue
distribution of intravenously administered gold nanoparticles
(AuNPs) in male rabbits. Rabbits were exposed to single dose of
AuNPs (300 μg/ kg). Toxic effects were assessed via general
behavior, hematological parameters, serum biochemical parameters,
and histopathological examination of various rabbits’ organs.
Inductively coupled plasma–mass spectrometry (ICP-MS) was used
to determine gold concentrations in tissue samples collected at
predetermined time intervals. After one week, AuNPs exerted no
obvious acute toxicity in rabbits. However, inflammatory reactions
were observed in liver, lungs and kidneys accompanied with mild
absolute neutrophilia and significant monocytosis. The highest gold
levels were found in the spleen and liver followed by lungs, and
kidneys. These results indicated that AuNPs could be distributed
extensively to various tissues in the body, but primarily in the spleen
and liver.
Abstract: In IA-MDT, the magnetic implants are placed
strategically at the target site to greatly and locally increase the
magnetic force on MDCPs and help to attract and retain the MDCPs
at the targeted region. In the present work, we develop a
mathematical model to study the capturing of magnetic nanoparticles
flowing within a fluid in an implant assisted cylindrical channel
under magnetic field. A coil of ferromagnetic SS-430 has been
implanted inside the cylindrical channel to enhance the capturing of
magnetic nanoparticles under magnetic field. The dominant magnetic
and drag forces, which significantly affect the capturing of
nanoparticles, are incorporated in the model. It is observed through
model results that capture efficiency increases as we increase the
magnetic field from 0.1 to 0.5 T, respectively. The increase in capture
efficiency by increase in magnetic field is because as the magnetic
field increases, the magnetization force, which is attractive in nature
and responsible to attract or capture the magnetic particles, increases
and results the capturing of large number of magnetic particles due to
high strength of attractive magnetic force.
Abstract: In this paper, we study the optical nonlinearities of
Silver sulfide (Ag2S) nanostructures dispersed in the Dimethyl
sulfoxide (DMSO) under exposure to 532 nm, 15 nanosecond (ns)
pulsed laser irradiation. Ultraviolet–visible absorption spectrometry
(UV-Vis), X-ray diffraction (XRD), and transmission electron
microscopy (TEM) are used to characterize the obtained nanocrystal
samples. The band gap energy of colloid is determined by analyzing
the UV–Vis absorption spectra of the Ag2S NPs using the band
theory of semiconductors. Z-scan technique is used to characterize
the optical nonlinear properties of the Ag2S nanoparticles (NPs).
Large enhancement of two photon absorption effect is observed with
increase in concentration of the Ag2S nanoparticles using open Zscan
measurements in the ns laser regime. The values of the nonlinear
absorption coefficients are determined based on the local nonlinear
responses including two photon absorption. The observed aperture
dependence of the Ag2S NP limiting performance indicates that the
nonlinear scattering plays an important role in the limiting action of
the sample. The concentration dependence of the optical liming is
also investigated. Our results demonstrate that the optical limiting
threshold decreases with increasing the silver sulfide NPs in DMSO.
Abstract: The use of engineered nanomaterials has increased as
a result of their positive impact on many sectors of the economy,
including agriculture. Silver nanoparticles (AgNPs) are now used to
enhance seed germination, plant growth, and photosynthetic quantum
efficiency and as antimicrobial agents to control plant diseases. In
this study, we examined the effect of AgNP dosage on the seed
germination of three plant species: corn (Zea mays L.), watermelon
(Citrullus lanatus [Thunb.] Matsum. & Nakai) and zucchini
(Cucurbita pepo L.). This experiment was designed to study the
effect of AgNPs on germination percentage, germination rate, mean
germination time, root length and fresh and dry weight of seedlings
for the three species. Seven concentrations (0.05, 0.1, 0.5, 1, 1.5, 2
and 2.5 mg/ml) of AgNPs were examined at the seed germination
stage. The three species had different dose responses to AgNPs in
terms of germination parameters and the measured growth
characteristics. The germination rates of the three plants were
enhanced in response to AgNPs. Significant enhancement of the
germination percentage values was observed after treatment of the
watermelon and zucchini plants with AgNPs in comparison with
untreated seeds. AgNPs showed a toxic effect on corn root
elongation, whereas watermelon and zucchini seedling growth were
positively affected by certain concentrations of AgNPs. This study
showed that exposure to AgNPs caused both positive and negative
effects on plant growth and germination.
Abstract: Doxorubicin (DOX) is an anthracycline drug used to treat many cancer diseases. Similarly to other cytostatic drugs, DOX has serious side effects; the biggest obstacle is the cardiotoxicity. With the aim of lowering the negative side effects and to target the DOX into the tumor tissue, the different nanoparticles (NPs) are studied. The aim of this work was to synthetized different NPs and conjugated them with DOX and determine the binding capacity of the NPs. For this experiment, carbon nanotubes (CNTs), graphene oxide (GO), fullerene (FUL) and liposomes (LIP) were used. The highest binding capacity was observed in GO (85%). Subsequently the toxicity of NPs and NPs-DOX conjugates was analyzed in in vivo system (chicken embryos). Some NPs (GO) can increase the toxicity of DOX, whereas other NPs (LIP, CNTs) decrease DOX toxicity.
Abstract: The use of engineered nanomaterials has increased as
a result of their positive impact on many sectors of the economy,
including agriculture. Silver nanoparticles (AgNPs) are now used to
enhance seed germination, plant growth, and photosynthetic quantum
efficiency and as antimicrobial agents to control plant diseases. In
this study, we examined the effect of AgNP dosage on the seed
germination of three plant species: corn (Zea mays L.), watermelon
(Citrullus lanatus [Thunb.] Matsum. & Nakai) and zucchini
(Cucurbita pepo L.). This experiment was designed to study the
effect of AgNPs on germination percentage, germination rate, mean
germination time, root length and fresh and dry weight of seedlings
for the three species. Seven concentrations (0.05, 0.1, 0.5, 1, 1.5, 2
and 2.5 mg/ml) of AgNPs were examined at the seed germination
stage. The three species had different dose responses to AgNPs in
terms of germination parameters and the measured growth
characteristics. The germination rates of the three plants were
enhanced in response to AgNPs. Significant enhancement of the
germination percentage values was observed after treatment of the
watermelon and zucchini plants with AgNPs in comparison with
untreated seeds. AgNPs showed a toxic effect on corn root
elongation, whereas watermelon and zucchini seedling growth were
positively affected by certain concentrations of AgNPs. This study
showed that exposure to AgNPs caused both positive and negative
effects on plant growth and germination.
Abstract: Surface modification and functionalization has been
an important tool for scientists in order to open new frontiers in
nanoscience and nanotechnology. Desired surface characteristics for
the intended applications can be achieved with surface
functionalization.
In this work, the effect of water soluble ligands on the adsorption
capabilities of silver nanoparticles onto AC which was synthesized
from German beech wood was investigated. Sodium borohydride
(NaBH4) and polyvinyl alcohol (PVA) were used as the ligands.
Silver nanoparticles with different surface coatings have average
sizes range from 10 to 13 nm. They were synthesized in aqueous
media by reducing Ag (I) ion in the presence of ligands. These
particles displayed adsorption tendencies towards AC when they
were mixed together and shaken in distilled water.
Silver nanoparticles (NaBH4-AgNPs) reduced and stabilized by
NaBH4 adsorbed onto AC with a homogenous dispersion of
aggregates with sizes in the range of 100-400 nm. Beside, silver
nanoparticles, which were prepared in the presence of both NaBH4
and PVA (NaBH4/PVA-Ag NPs), demonstrated that NaBH4/PVA-Ag
NPs adsorbed and dispersed homogenously but, they aggregated with
larger sizes on the AC surface (range from 300 to 600 nm). In
addition, desorption resistance of Ag nanoparticles were investigated
in distilled water. According to the results AgNPs were not desorbed
on the AC surface in distilled water.
Abstract: An environmentally benign protocol for the one-pot,
three-component synthesis of Triazolo[1,2-a]indazole-1,3,8-trione
derivatives by condensation of dimedone, urazole and aromatic
aldehydes catalyzed by HClO4/SiO2 NPS as an ecofriendly catalyst
with high catalytic activity and reusability at 100ºC under solventfree
conditions is reported. The reaction proceeds to completion
within 20-30 min in 77-86% yield.
Abstract: The contact resistance between source/drain electrodes
and semiconductor layer is an important parameter affecting electron
transporting performance in the thin film transistor (TFT). In this
work, we introduced a transparent and the solution prossable
single-walled carbon nanotube (SWCNT)/Al-doped ZnO nano particle
(AZO NP) bilayer electrodes showing low contact resistance with
indium-oxide (In2O3) sol gel thin film. By inserting low work function
AZO NPs into the interface between the SWCNTs and the In2O3 which
has a high energy barrier, we could obtain an electrical Ohmic contact
between them. Finally, with the SWCNT-AZO NP bilayer electrodes,
we successfully fabricated a TFT showing a field effect mobility of
5.38 cm2/V·s at 250°C.
Abstract: Monoamine oxidase A gene (MAOA) is suggested to
be a candidate gene implicated in many neuropsychiatric disorders,
including autism spectrum disorder (ASD). This meta-analytic review
evaluates the relationship between ASD and MAOA markers such as
30 bp variable number tandem repeats in the promoter region
(uVNTR) and single nucleotide polymorphisms (SNPs) by using
findings from recently published studies. It seems that in Caucasian
males, the risk of developing ASD increase with the presence of 4-
repeat allele in the promoter region of MAOA gene whereas no
differences were found between autistic patients and controls in
Egyptian, West Bengal and Korean population. Some studies point to
the importance of specific haplotype groups of SNPs and interaction
of MAOA with others genes (e. g. FOXP2 or SRY). The results of
existing studies are insufficient and further research is needed.
Abstract: Rhodamine B (RB) is a toxic dye used extensively in
textile industry, which must be remediated before its drainage to
environment. In the present study, supported gold nanoparticles on
commercially available titania and zincite were successfully prepared
and then their activity on the photodegradation of RB under UV A
light irradiation were evaluated. The synthesized photocatalysts were
characterized by ICP, BET, XRD, and TEM. Kinetic results showed
that Au/TiO2 was an inferior photocatalyst to Au/ZnO. This
observation could be attributed to the strong reflection of UV
irradiation by gold nanoparticles over TiO2 support.
Abstract: Metal-enhanced Luminescence of silicon nanocrystals
(SiNCs) was determined using two different particle sizes of silver
nanoparticles (AgNPs). SiNCs have been characterized by scanning
electron microscopy (SEM), high resolution transmission electron
microscopy (HRTEM), Fourier transform infrared spectroscopy
(FTIR) and X-ray photoelectron spectroscopy (XPS). It is found that
the SiNCs are crystalline with an average diameter of 65 nm and FCC
lattice. AgNPs were synthesized using photochemical reduction of
AgNO3 with sodium dodecyl sulphate (SDS). The enhanced
luminescence of SiNCs by AgNPs was evaluated by confocal Raman
microspectroscopy. Enhancement up to x9 and x3 times were
observed for SiNCs that mixed with AgNPs which have an average
particle size of 100 nm and 30 nm, respectively. Silver NPs-enhanced
luminescence of SiNCs occurs as a result of the coupling between the
excitation laser light and the plasmon bands of AgNPs; thus this
intense field at AgNPs surface couples strongly to SiNCs.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.