Abstract: In this paper, we present a low complexity hybrid scheme using conventional selective mapping (C-SLM) and clipping algorithms to reduce the high peak-to-average power ratio (PAPR) of orthogonal frequency division multiplexing (OFDM) signal. In the proposed scheme, the input data sequence (X) is divided into two sub-blocks, then clipping algorithm is applied to the first sub-block, whereas C-SLM algorithm is applied to the second sub-block in order to reduce both computational complexity and PAPR. The resultant time domain OFDM signal is obtained by combining the output of two sub-blocks. The simulation results show that the proposed hybrid scheme provides 0.45 dB PAPR reduction gain at CCDF value of 10-2 and 52% of computational complexity reduction when compared to C-SLM scheme at the expense of slight degradation in bit error rate (BER) performance.
Abstract: Beppu hot spring provides medical treatment as well as comfort visitors and mental easiness for many years. This paper studies hot spring in Beppu and Tōji, medical treatment in hot spring, and investigates how people’s visit to Beppu has changed with Tōji, and how Beppu Tourism Office tries to regain visitors in Beppu. In this paper, firstly, hot spring history in Beppu will be explained especially focusing on Beppu Hattou (eight major hot springs) and Jigoku Meguri (eight major hell hot spring tours). Secondly, Tōji, a long-residential hot spring with the purpose of medical treatment along with the information about chemical efficacy of hot springs will be analyzed. Then, finally, the change of the long-stay type to short-stay Onsen programs with the combination of multiplex tourism resources will be focused along with the decrease of Onsen or hot spring visitors. It is concluded that Tōji is not only physically and mentally cure people but also bring people mental easiness and release them from their stressful life. All in all, it can be concluded that because Onsen is involved in people’s life in Beppu and keep local people united in the community. Tōji’s attraction is shown when local people try to create the new type of Onsen program so as to keep their traditional way of Tōji.
Abstract: In recent years, a multi-antenna system is actively used
to improve the performance of the communication. A MIMO-OFDM
system can provide multiplexing gain or diversity gain. These gains
are obtained in proportion to the increase of the number of antennas.
In order to provide the optimal gain of the MIMO-OFDM system,
various transmission and reception schemes are presented. This paper
aims to propose a hybrid scheme that base station provides both
diversity gain and multiplexing gain at the same time.
Abstract: Orthogonal Frequency Division Multiplexing
(OFDM) has been used in many advanced wireless communication
systems due to its high spectral efficiency and robustness to
frequency selective fading channels. However, the major concern
with OFDM system is the high peak-to-average power ratio (PAPR)
of the transmitted signal. Some of the popular techniques used for
PAPR reduction in OFDM system are conventional partial transmit
sequences (CPTS) and clipping. In this paper, a parallel
combination/hybrid scheme of PAPR reduction using clipping and
CPTS algorithms is proposed. The proposed method intelligently
applies both the algorithms in order to reduce both PAPR as well as
computational complexity. The proposed scheme slightly degrades
bit error rate (BER) performance due to clipping operation and it can
be reduced by selecting an appropriate value of the clipping ratio
(CR). The simulation results show that the proposed algorithm
achieves significant PAPR reduction with much reduced
computational complexity.
Abstract: Digital images are widely used in computer
applications. To store or transmit the uncompressed images
requires considerable storage capacity and transmission bandwidth.
Image compression is a means to perform transmission or storage of
visual data in the most economical way. This paper explains about
how images can be encoded to be transmitted in a multiplexing
time-frequency domain channel. Multiplexing involves packing
signals together whose representations are compact in the working
domain. In order to optimize transmission resources each 4 × 4
pixel block of the image is transformed by a suitable polynomial
approximation, into a minimal number of coefficients. Less than
4 × 4 coefficients in one block spares a significant amount of
transmitted information, but some information is lost. Different
approximations for image transformation have been evaluated as
polynomial representation (Vandermonde matrix), least squares +
gradient descent, 1-D Chebyshev polynomials, 2-D Chebyshev
polynomials or singular value decomposition (SVD). Results have
been compared in terms of nominal compression rate (NCR),
compression ratio (CR) and peak signal-to-noise ratio (PSNR)
in order to minimize the error function defined as the difference
between the original pixel gray levels and the approximated
polynomial output. Polynomial coefficients have been later encoded
and handled for generating chirps in a target rate of about two
chirps per 4 × 4 pixel block and then submitted to a transmission
multiplexing operation in the time-frequency domain.
Abstract: Wavelength Division Multiplexing (WDM)
technology is the most promising technology for the proper
utilization of huge raw bandwidth provided by an optical fiber. One
of the key problems in implementing the all-optical WDM network is
the packet contention. This problem can be solved by several
different techniques. In time domain approach the packet contention
can be reduced by incorporating Fiber Delay Lines (FDLs) as optical
buffer in the switch architecture. Different types of buffering
architectures are reported in literatures. In the present paper a
comparative performance analysis of three most popular FDL
architectures are presented in order to obtain the best contention
resolution performance. The analysis is further extended to consider
the effect of different fiber non-linearities on the network
performance.
Abstract: The analytical bright two soliton solution of the 3-
coupled nonlinear Schrödinger equations with variable coefficients in
birefringent optical fiber is obtained by Darboux transformation
method. To the design of ultra-speed optical devices, Soliton
interaction and control in birefringence fiber is investigated. Lax pair
is constructed for N coupled NLS system through AKNS method.
Using two-soliton solution, we demonstrate different interaction
behaviors of solitons in birefringent fiber depending on the choice of
control parameters. Our results shows that interactions of optical
solitons have some specific applications such as construction of logic
gates, optical computing, soliton switching, and soliton amplification
in wavelength division multiplexing (WDM) system.
Abstract: In this paper, a novel fuzzy approach is developed
while solving the Dynamic Routing and Wavelength Assignment
(DRWA) problem in optical networks with Wavelength Division
Multiplexing (WDM). In this work, the effect of nonlinear and linear
impairments such as Four Wave Mixing (FWM) and amplifier
spontaneous emission (ASE) noise are incorporated respectively. The
novel algorithm incorporates fuzzy logic controller (FLC) to reduce
the effect of FWM noise and ASE noise on a requested lightpath
referred in this work as FWM aware fuzzy dynamic routing and
wavelength assignment algorithm. The FWM crosstalk products and
the static FWM noise power per link are pre computed in order to
reduce the set up time of a requested lightpath, and stored in an
offline database. These are retrieved during the setting up of a
lightpath and evaluated online taking the dynamic parameters like
cost of the links into consideration.
Abstract: Multiple Input Multiple Output (MIMO) systems are
wireless systems with multiple antenna elements at both ends of the
link. Wireless communication systems demand high data rate and
spectral efficiency with increased reliability. MIMO systems have
been popular techniques to achieve these goals because increased
data rate is possible through spatial multiplexing scheme and
diversity. Spatial Multiplexing (SM) is used to achieve higher
possible throughput than diversity. In this paper, we propose a Zero-
Forcing (ZF) detection using a combination of Ordered Successive
Interference Cancellation (OSIC) and Zero Forcing using
Interference Cancellation (ZF-IC). The proposed method used an
OSIC based on Signal to Noise Ratio (SNR) ordering to get the
estimation of last symbol, then the estimated last symbol is
considered to be an input to the ZF-IC. We analyze the Bit Error Rate
(BER) performance of the proposed MIMO system over Rayleigh
Fading Channel, using Binary Phase Shift Keying (BPSK)
modulation scheme. The results show better performance than the
previous methods.
Abstract: The Orthogonal Frequency Division Multiplexing
(OFDM) with high data rate, high spectral efficiency and its ability to
mitigate the effects of multipath makes them most suitable in wireless
application. Impulsive noise distorts the OFDM transmission and
therefore methods must be investigated to suppress this noise. In this
paper, a State Space Recursive Least Square (SSRLS) algorithm
based adaptive impulsive noise suppressor for OFDM
communication system is proposed. And a comparison with another
adaptive algorithm is conducted. The state space model-dependent
recursive parameters of proposed scheme enables to achieve steady
state mean squared error (MSE), low bit error rate (BER), and faster
convergence than that of some of existing algorithm.
Abstract: We propose new multiple-channel piezoelectric (PZT)
actuated tunable optical filter based on racetrack multi-ring
resonators for wavelength de-multiplexing network applications. We
design tunable eight-channel wavelength de-multiplexer consisting of
eight cascaded PZT actuated tunable multi-ring resonator filter with a
channel spacing of 1.6nm. The filter for each channel is basically
structured on a suspended beam, sandwiched with piezoelectric
material and built in integrated ring resonators which are placed on
the middle of the beam to gain uniform stress and linearly varying
longitudinal strain. A reference single mode serially coupled multi
stage racetrack ring resonator with the same radii and coupling length
is designed with a line width of 0.8974nm with a flat top pass band at
1dB of 0.5205nm and free spectral range of about 14.9nm. In each
channel, a small change in the perimeter of the rings is introduced to
establish the shift in resonance wavelength as per the defined channel
spacing. As a result, when a DC voltage is applied, the beams will
elongate, which involves mechanical deformation of the ring
resonators that induces a stress and a strain, which brings a change in
refractive index and perimeter of the rings leading to change in the
output spectrum shift providing the tunability of central wavelength
in each channel. Simultaneous wave length shift as high as
45.54pm/
Abstract: Wavelength Division Multiplexing (WDM) is the dominant transport technology used in numerous high capacity backbone networks, based on optical infrastructures. Given the importance of costs (CapEx and OpEx) associated to these networks, resource management is becoming increasingly important, especially how the optical circuits, called “lightpaths”, are routed throughout the network. This requires the use of efficient algorithms which provide routing strategies with the lowest cost. We focus on the lightpath routing and wavelength assignment problem, known as the RWA problem, while optimizing wavelength fragmentation over the network. Wavelength fragmentation poses a serious challenge for network operators since it leads to the misuse of the wavelength spectrum, and then to the refusal of new lightpath requests. In this paper, we first establish a new Integer Linear Program (ILP) for the problem based on a node-link formulation. This formulation is based on a multilayer approach where the original network is decomposed into several network layers, each corresponding to a wavelength. Furthermore, we propose an efficient heuristic for the problem based on a greedy algorithm followed by a post-treatment procedure. The obtained results show that the optimal solution is often reached. We also compare our results with those of other RWA heuristic methods
Abstract: We address a new integer frequency offset (IFO)
estimation scheme with an aid of a pilot for orthogonal frequency
division multiplexing systems. After correlating each continual pilot
with a predetermined scattered pilot, the correlation value is again
correlated to alleviate the influence of the timing offset. From
numerical results, it is demonstrated that the influence of the timing
offset on the IFO estimation is significantly decreased.
Abstract: This paper presents system level CMOS solid-state
nanopore techniques enhancement for speedup next generation
molecular recording and high throughput channels. This discussion
also considers optimum number of base-pair (bp) measurements
through channel as an important role to enhance potential read
accuracy. Effective power consumption estimation offered suitable
range of multi-channel configuration. Nanopore bp extraction model
in statistical method could contribute higher read accuracy with
longer read-length (200 < read-length). Nanopore ionic current
switching with Time Multiplexing (TM) based multichannel readout
system contributed hardware savings.
Abstract: In this paper, we investigate the effect of friendly
jamming power allocation strategies on the achievable average
secrecy rate over a bank of parallel fading wiretap channels.
We investigate the achievable average secrecy rate in parallel
fading wiretap channels subject to Rayleigh and Rician fading.
The achievable average secrecy rate, due to the presence of a
line-of-sight component in the jammer channel is also evaluated.
Moreover, we study the detrimental effect of correlation across the
parallel sub-channels, and evaluate the corresponding decrease in the
achievable average secrecy rate for the various fading configurations.
We also investigate the tradeoff between the transmission power
and the jamming power for a fixed total power budget. Our
results, which are applicable to current orthogonal frequency division
multiplexing (OFDM) communications systems, shed further light on
the achievable average secrecy rates over a bank of parallel fading
channels in the presence of friendly jammers.
Abstract: We address the integer frequency offset (IFO)
estimation under the influence of the timing offset (TO) in orthogonal
frequency division multiplexing (OFDM) systems. Incorporating the
IFO and TO into the symbol set used to represent the received
OFDM symbol, we investigate the influence of the TO on the IFO,
and then, propose a combining method between two consecutive
OFDM correlations, reducing the influence. The proposed scheme
has almost the same complexity as that of the conventional
schemes, whereas it does not need the TO knowledge contrary to
the conventional schemes. From numerical results it is confirmed
that the proposed scheme is insensitive to the TO, consequently,
yielding an improvement of the IFO estimation performance over
the conventional schemes when the TO exists.
Abstract: High Peak to Average Power Ratio (PAPR) of the
transmitted signal is a serious problem in multicarrier systems (MC),
such as Orthogonal Frequency Division Multiplexing (OFDM), or in
Multi-Carrier Code Division Multiple Access (MC-CDMA) systems,
due to large number of subcarriers. This effect is possible reduce with
some PAPR reduction techniques. Spreading sequences at the
presence of Saleh and Rapp models of high power amplifier (HPA)
have big influence on the behavior of system. In this paper we
investigate the bit-error-rate (BER) performance of MC-CDMA
systems. Basically we can see from simulations that the MC-CDMA
system with Iterative algorithm can be providing significantly better
results than the MC-CDMA system. The results of our analyses are
verified via simulation.
Abstract: The idea of the asynchronous transmission in
wavelength division multiplexing (WDM) ring MANs is studied in
this paper. Especially, we present an efficient access technique to
coordinate the collisions-free transmission of the variable sizes of IP
traffic in WDM ring core networks. Each node is equipped with a
tunable transmitter and a tunable receiver. In this way, all the
wavelengths are exploited for both transmission and reception. In
order to evaluate the performance measures of average throughput,
queuing delay and packet dropping probability at the buffers, a
simulation model that assumes symmetric access rights among the
nodes is developed based on Poisson statistics. Extensive numerical
results show that the proposed protocol achieves apart from high
bandwidth exploitation for a wide range of offered load, fairness of
queuing delay and dropping events among the different packets size
categories.
Abstract: This paper impart the design and testing of
Nanotechnology based sequential circuits using multiplexer
conservative QCA (MX-CQCA) logic gates, which is easily testable
using only two vectors. This method has great prospective in the
design of sequential circuits based on reversible conservative logic
gates and also smashes the sequential circuits implemented in
traditional gates in terms of testability. Reversible circuits are similar
to usual logic circuits except that they are built from reversible gates.
Designs of multiplexer conservative QCA logic based two vectors
testable double edge triggered (DET) sequential circuits in VHDL
language are also accessible here; it will also diminish intricacy in
testing side. Also other types of sequential circuits such as D, SR, JK
latches are designed using this MX-CQCA logic gate. The objective
behind the proposed design methodologies is to amalgamate
arithmetic and logic functional units optimizing key metrics such as
garbage outputs, delay, area and power. The projected MX-CQCA
gate outshines other reversible gates in terms of the intricacy, delay.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.