Abstract: Analysis of EEG brainwave provides information on mental or emotional states. One of the particular states that can have various applications in human machine interface (HMI) is concentration. 8-channel EEG signals were measured and analyzed. The concentration index was compared during resting and concentrating periods. Among eight channels, locations the frontal lobe (Fp1 and Fp2) showed a clear increase of the concentration index during concentration regardless of subjects. The rest six channels produced conflicting observations depending on subjects. At this time, it is not clear whether individual difference or how to concentrate made these results for the rest six channels. Nevertheless, it is expected that Fp1 and Fp2 are promising locations for extracting control signal for HMI applications.
Abstract: Recently there has been a dramatic proliferation in
the number of social networking sites (SNSs) users; however, little
is published about what motivates college students to use SNSs in
education. The main goal of this research is to explore the college
students’ motives for using SNSs in education. A conceptual
framework has therefore been developed to identify the main
factors that influence/motivate students to use social networking
sites for learning purposes. To achieve the research objectives a
quantitative method was used to collect data. A questionnaire has
been distributed amongst college students. The results reveal that
social influence, perceived enjoyment, institute regulation,
perceived usefulness, ranking up-lift, attractiveness,
communication tools, free of charge, sharing material and course
nature all play an important role in the motivation of college
students to use SNSs for learning purposes.
Abstract: In the past, the most comprehensively adopted light
source was incandescent light bulbs, but with the appearance of LED
light sources, traditional light sources have been gradually replaced by
LEDs because of its numerous superior characteristics. However,
many of the standards do not apply to LEDs as the two light sources
are characterized differently. This also intensifies the significance of
studies on LEDs. As a Kansei design study investigating the visual
glare produced by traffic arrows implemented with LEDs, this study
conducted a semantic analysis on the styles of traffic arrows used in
domestic and international occasions. The results will be able to
reduce drivers’ misrecognition that results in the unsuccessful arrival
at the destination, or in traffic accidents. This study started with a
literature review and surveyed the status quo before conducting
experiments that were divided in two parts. The first part involved a
screening experiment of arrow samples, where cluster analysis was
conducted to choose five representative samples of LED displays. The
second part was a semantic experiment on the display of arrows using
LEDs, where the five representative samples and the selected ten
adjectives were incorporated. Analyzing the results with
Quantification Theory Type I, it was found that among the
composition of arrows, fletching was the most significant factor that
influenced the adjectives. In contrast, a “no fletching” design was
more abstract and vague. It lacked the ability to convey the intended
message and might bear psychological negative connotation including
“dangerous,” “forbidden,” and “unreliable.” The arrow design
consisting of “> shaped fletching” was found to be more concrete and
definite, showing positive connotation including “safe,” “cautious,”
and “reliable.” When a stimulus was placed at a farther distance, the
glare could be significantly reduced; moreover, the visual evaluation
scores would be higher. On the contrary, if the fletching and the shaft
had a similar proportion, looking at the stimuli caused higher
evaluation at a closer distance. The above results will be able to be
applied to the design of traffic arrows by conveying information
definitely and rapidly. In addition, drivers’ safety could be enhanced
by understanding the cause of glare and improving visual
recognizability.
Abstract: Advances in the field of image processing envision a
new era of evaluation techniques and application of procedures in
various different fields. One such field being considered is the
biomedical field for prognosis as well as diagnosis of diseases. This
plethora of methods though provides a wide range of options to select
from, it also proves confusion in selecting the apt process and also in
finding which one is more suitable. Our objective is to use a series of
techniques on bone scans, so as to detect the occurrence of
rheumatoid arthritis (RA) as accurately as possible. Amongst other
techniques existing in the field our proposed system tends to be more
effective as it depends on new methodologies that have been proved
to be better and more consistent than others. Computer aided
diagnosis will provide more accurate and infallible rate of
consistency that will help to improve the efficiency of the system.
The image first undergoes histogram smoothing and specification,
morphing operation, boundary detection by edge following algorithm
and finally image subtraction to determine the presence of
rheumatoid arthritis in a more efficient and effective way. Using preprocessing
noises are removed from images and using segmentation,
region of interest is found and Histogram smoothing is applied for a
specific portion of the images. Gray level co-occurrence matrix
(GLCM) features like Mean, Median, Energy, Correlation, Bone
Mineral Density (BMD) and etc. After finding all the features it
stores in the database. This dataset is trained with inflamed and noninflamed
values and with the help of neural network all the new
images are checked properly for their status and Rough set is
implemented for further reduction.
Abstract: Compost can influence soil fertility and plant health. At the same time compost can play an important role in the nitrogen cycle and it can influence leaching of mineral nitrogen from soil to underground water.
This paper deals with the influence of compost addition and mineral nitrogen fertilizer on leaching of mineral nitrogen, nitrogen availability in microbial biomass and plant biomass production in the lysimetric experiment. Twenty one lysimeters were filed with topsoil and subsoil collected in the area of protection zone of underground source of drinking water - Březová nad Svitavou. The highest leaching of mineral nitrogen was detected in the variant fertilized only mineral nitrogen fertilizer (624.58 mg m-2), the lowest leaching was recorded in the variant with high addition of compost (315.51 mg m-2). On the other hand, losses of mineral nitrogen are not in connection with the losses of available form of nitrogen in microbial biomass. Because lost of mineral nitrogen was detected in variant with the least change in the availability of N in microbial biomass.
The leaching of mineral nitrogen, yields as well as the results concerning nitrogen availability from the first year of long term experiment suggest that compost can positive influence the leaching of nitrogen into underground water.
Abstract: Photoacoustic imaging (PAI) is a non-invasive and
non-ionizing imaging modality that combines the absorption contrast
of light with ultrasound resolution. Laser is used to deposit optical
energy into a target (i.e., optical fluence). Consequently, the target
temperature rises, and then thermal expansion occurs that leads to
generating a PA signal. In general, most image reconstruction
algorithms for PAI assume uniform fluence within an imaging object.
However, it is known that optical fluence distribution within the
object is non-uniform. This could affect the reconstruction of PA
images. In this study, we have investigated the influence of optical
fluence distribution on PA back-propagation imaging using finite
element method. The uniform fluence was simulated as a triangular
waveform within the object of interest. The non-uniform fluence
distribution was estimated by solving light propagation within a
tissue model via Monte Carlo method. The results show that the PA
signal in the case of non-uniform fluence is wider than the uniform
case by 23%. The frequency spectrum of the PA signal due to the
non-uniform fluence has missed some high frequency components in
comparison to the uniform case. Consequently, the reconstructed
image with the non-uniform fluence exhibits a strong smoothing
effect.
Abstract: Children today use computer based application in
various activities especially for learning and education. Many of
these tools and application such as the Computer Aided
Pronunciation Training (CAPT) systems enable children to explore
and experience them with little supervision from the adults. In order
for these tools and application to have maximum effect on the
children’s learning and education, it must be attractive to the children
to use them. This could be achieved with the proper user interface
(UI) design. As children grow, so do their ability, taste and
preferences. They interact differently with these applications as they
grow older. This study reviews several articles on how age factors
influence the UI design. The review focuses on age related abilities
such as cognitive, literacy, concentration and feedback requirement.
We have also evaluated few of existing CAPT systems and determine
the influence of age-based factors on the interface design.
Abstract: This paper presents a neural network based model predictive control (MPC) strategy to control a strongly exothermic reaction with complicated nonlinear kinetics given by Chylla-Haase polymerization reactor that requires a very precise temperature control to maintain product uniformity. In the benchmark scenario, the operation of the reactor must be guaranteed under various disturbing influences, e.g., changing ambient temperatures or impurity of the monomer. Such a process usually controlled by conventional cascade control, it provides a robust operation, but often lacks accuracy concerning the required strict temperature tolerances. The predictive control strategy based on the RBF neural model is applied to solve this problem to achieve set-point tracking of the reactor temperature against disturbances. The result shows that the RBF based model predictive control gives reliable result in the presence of some disturbances and keeps the reactor temperature within a tight tolerance range around the desired reaction temperature.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: Prior literature on innovation diffusion or acceptance has almost exclusively concentrated on consumers’ positive attitudes and behaviors for new products/services. Consumers’ negative attitudes or behaviors to innovations have received relatively little marketing attention, but it happens frequently in practice. This study discusses consumer psychological factors when they try to learn or use new technologies. According to recent research, technological innovation acceptance has been considered as a dynamic or mediated process. This research argues that consumers can experience inertia and emotions in the initial use of new technologies. However, given such consumer psychology, the argument can be made as to whether the inclusion of consumer inertia (routine seeking and cognitive rigidity) and emotions increases the predictive power of new technology acceptance model. As data from the empirical study find, the process is potentially consumer emotion changing (independent of performance benefits) because of technology complexity and consumer inertia, and impact innovative technology use significantly. Finally, the study presents the superior predictability of the hypothesized model, which let managers can better predict and influence the successful diffusion of complex technological innovations.
Abstract: Combustion phenomenon will be accomplished
effectively by the development of low emission combustor. One of the
significant factors influencing the entire Combustion process is the
mixing between a swirling angular jet (Primary Air) and the
non-swirling inner jet (fuel). To study this fundamental flow, the
chamber had to be designed in such a manner that the combustion
process to sustain itself in a continuous manner and the temperature of
the products is sufficiently below the maximum working temperature
in the turbine. This study is used to develop the effective combustion
with low unburned combustion products by adopting the concept of
high swirl flow and motility of holes in the secondary chamber. The
proper selection of a swirler is needed to reduce emission which can be
concluded from the emission of Nox and CO2. The capture of CO2 is
necessary to mitigate CO2 emissions from natural gas. Thus the
suppression of unburned gases is a meaningful objective for the
development of high performance combustor without affecting turbine
blade temperature.
Abstract: Chittagong is the commercial capital of Bangladesh.
Here Agrabad is one of the most commercial activity centers of
Chittagong. Due to many light industry and commercial land use,
Agrabad to CEPZ road at Agrabad is the only major road of
Chittagong port city which encompasses a huge number of vehicles
every day. It has many junctions which distribute traffic flow in
different roads. In these junctions vehicles gather at some conflict
point to create traffic jam and make the performance of the road
downward. This study is parallel focused on the existing level of
service with traffic volume, capacity, and speed by traffic survey.
After all of these analyses the performance of the road is determined
with finding the factors that influences the performance.
Abstract: With the advances in information and communications technology, mobile context-aware applications have become powerful marketing tools. In Apple online store, there are numerous mobile applications (APPs) developed for destination tour. This study investigated the determinants of adoption of context-aware APPs for destination tour services. A model is proposed based on Technology Acceptance Model and privacy concern theory. The model was empirically tested based on a sample of 259 users of a tourism APP published by Kaohsiung Tourism Bureau, Taiwan. The results showed that the fitness of the model is well and, among all the factors, the perceived usefulness and perceived ease of use have the most significant influences on the intention to adopt context-aware destination APPs. Finally, contrary to the findings of previous literature, the effect of privacy concern on the adoption intention of context-aware APP is insignificant.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: This study aim at the influence of college students’ exercise and leisure motivations on the leisure benefits while using the leisure involvement as a moderator. Whereby, the research tools used in this study included the application of leisure motivation scale, leisure involvement scale and leisure benefits scale, and a hierarchical regression analysis was performed by using a questionnaire-based survey, in which, a total of 1,500 copies of questionnaires were administered and 917 valid questionnaires were obtained, achieving a response rate of 61.13%. Research findings explore that leisure involvement has a moderating effect on the relationship between the leisure motivation and leisure benefits.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.