Pe - Journal Author

Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women

Year: 2014 Volume: 8 Issue: 9 618 - 621 Pages

Abstract: Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.

Optimization of Switched Reluctance Motor for Drive System in Automotive Applications

Year: 2014 Volume: 8 Issue: 9 1611 - 1618 Pages

Abstract: The purpose of this work is to optimize a Switched Reluctance Motor (SRM) for an automotive application, specifically for a fully electric car. A new optimization approach is proposed. This unique approach transforms automotive customer requirements into an optimization problem, based on sound knowledge of a SRM theory. The approach combines an analytical and a finite element analysis of the motor to quantify static nonlinear and dynamic performance parameters, as phase currents and motor torque maps, an output power and power losses in order to find the optimal motor as close to the reality as possible, within reasonable time. The new approach yields the optimal motor which is competitive with other types of already proposed motors for automotive applications. This distinctive approach can also be used to optimize other types of electrical motors, when parts specifically related to the SRM are adjusted accordingly.

Effect of Packaging Methods and Storage Time on Oxidative Stability of Traditional Fermented Sausage

Year: 2014 Volume: 8 Issue: 9 1027 - 1030 Pages

Abstract: In this paper influence of packaging method (vacuum and modified atmosphere packaging) on lipid oxidative stability and sensory properties of odor and taste of the traditional sausage Petrovská klobása were examined. These parameters were examined during storage period (7 months). In the end of storage period, vacuum packed sausage showed better oxidative stability. Propanal content was significantly lower (P

Decision Analysis Module for Excel

Year: 2014 Volume: 8 Issue: 9 3018 - 3021 Pages

Abstract: The Analytic Hierarchy Process is frequently used approach for solving decision making problems. There exists wide range of software programs utilizing that approach. Their main disadvantage is that they are relatively expensive and missing intermediate calculations. This work introduces a Microsoft Excel add-in called DAME – Decision Analysis Module for Excel. Comparing to other computer programs DAME is free, can work with scenarios or multiple decision makers and displays intermediate calculations. Users can structure their decision models into three levels – scenarios/users, criteria and variants. Items on all levels can be evaluated either by weights or pair-wise comparisons. There are provided three different methods for the evaluation of the weights of criteria, the variants as well as the scenarios – Saaty’s Method, Geometric Mean Method and Fuller’s Triangle Method. Multiplicative and additive syntheses are supported. The proposed software package is demonstrated on couple of illustrating examples of real life decision problems.

A Study of Semantic Analysis of LED Illustrated Traffic Directional Arrow in Different Style

Year: 2014 Volume: 8 Issue: 8 2683 - 2691 Pages

Abstract: In the past, the most comprehensively adopted light source was incandescent light bulbs, but with the appearance of LED light sources, traditional light sources have been gradually replaced by LEDs because of its numerous superior characteristics. However, many of the standards do not apply to LEDs as the two light sources are characterized differently. This also intensifies the significance of studies on LEDs. As a Kansei design study investigating the visual glare produced by traffic arrows implemented with LEDs, this study conducted a semantic analysis on the styles of traffic arrows used in domestic and international occasions. The results will be able to reduce drivers’ misrecognition that results in the unsuccessful arrival at the destination, or in traffic accidents. This study started with a literature review and surveyed the status quo before conducting experiments that were divided in two parts. The first part involved a screening experiment of arrow samples, where cluster analysis was conducted to choose five representative samples of LED displays. The second part was a semantic experiment on the display of arrows using LEDs, where the five representative samples and the selected ten adjectives were incorporated. Analyzing the results with Quantification Theory Type I, it was found that among the composition of arrows, fletching was the most significant factor that influenced the adjectives. In contrast, a “no fletching” design was more abstract and vague. It lacked the ability to convey the intended message and might bear psychological negative connotation including “dangerous,” “forbidden,” and “unreliable.” The arrow design consisting of “> shaped fletching” was found to be more concrete and definite, showing positive connotation including “safe,” “cautious,” and “reliable.” When a stimulus was placed at a farther distance, the glare could be significantly reduced; moreover, the visual evaluation scores would be higher. On the contrary, if the fletching and the shaft had a similar proportion, looking at the stimuli caused higher evaluation at a closer distance. The above results will be able to be applied to the design of traffic arrows by conveying information definitely and rapidly. In addition, drivers’ safety could be enhanced by understanding the cause of glare and improving visual recognizability.

Human Tracking across Heterogeneous Systems Based On Mobile Agent Technologies

Year: 2014 Volume: 8 Issue: 8 1460 - 1464 Pages

Abstract: In a human tracking system, expanding a monitoring range of one system is complicating the management of devices and increasing its cost. Therefore, we propose a method to realize a wide-range human tracking by connecting small systems. In this paper, we examined an agent deploy method and information contents across the heterogeneous human tracking systems. By implementing the proposed method, we can construct a human tracking system across heterogeneous systems, and the system can track a target continuously between systems.

Hypergraph Models of Metabolism

Year: 2014 Volume: 8 Issue: 8 896 - 900 Pages

Abstract: In this paper, we employ a directed hypergraph model to investigate the extent to which environmental variability influences the set of available biochemical reactions within a living cell. Such an approach avoids the limitations of the usual complex network formalism by allowing for the multilateral relationships (i.e. connections involving more than two nodes) that naturally occur within many biological processes. More specifically, we extend the concept of network reciprocity to complex hyper-networks, thus enabling us to characterise a network in terms of the existence of mutual hyper-connections, which may be considered a proxy for metabolic network complexity. To demonstrate these ideas, we study 115 metabolic hyper-networks of bacteria, each of which can be classified into one of 6 increasingly varied habitats. In particular, we found that reciprocity increases significantly with increased environmental variability, supporting the view that organism adaptability leads to increased complexities in the resultant biochemical networks.

Calibration Model of %Titratable Acidity (Citric Acid) for Intact Tomato by Transmittance SW-NIR Spectroscopy

Year: 2014 Volume: 8 Issue: 8 892 - 895 Pages

Abstract: The acidity (citric acid) is the one of chemical content that can be refer to the internal quality and it’s a maturity index of tomato, The titratable acidity (%TA) can be predicted by a non-destructive method prediction by using the transmittance short wavelength (SW-NIR) spectroscopy in the wavelength range between 665-955 nm. The set of 167 tomato samples divided into groups of 117 tomatoes sample for training set and 50 tomatoes sample for test set were used to establish the calibration model to predict and measure %TA by partial least squares regression (PLSR) technique. The spectra were pretreated with MSC pretreatment and it gave the optimal result for calibration model as (R = 0.92, RMSEC = 0.03%) and this model obtained high accuracy result to use for %TA prediction in test set as (R = 0.81, RMSEP = 0.05%). From the result of prediction in test set shown that the transmittance SW-NIR spectroscopy technique can be used for a non-destructive method for %TA prediction of tomato.

An AFM Approach of RBC Micro and Nanoscale Topographic Features during Storage

Year: 2014 Volume: 8 Issue: 8 517 - 520 Pages

Abstract: Blood gamma irradiation is the only available method to prevent transfusion associated graft versus host disease (TAGVHD). However, when blood is irradiated, determine blood shelf time is crucial. Non irradiated blood have a self-time from 21 to 35 days when is preserved with anticoagulated solution and stored at 4°C. During their storage, red blood cells (RBC) undergo a series of biochemical, biomechanical and molecular changes involving what is known as storage lesion (SL). SL include loss of structural integrity of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and increase of both ion potassium concentration and hemoglobin (Hb). On the other hand, Atomic force Microscopy (AFM) represents a versatile tool for a nano-scale high resolution topographic analysis in biological systems. In order to evaluate SL in irradiated and nonirradiated blood, RBC topography and morphometric parameters were obtained from an AFM XE-BIO system. Cell viability was followed using flow cytometry. Our results showed that early markers as nanoscale roughness, allow us to evaluate blood quality since other perspective.

Metal-Based Anticancer Agents: In vitro DNA Binding, Cleavage and Cytotoxicity

Year: 2014 Volume: 8 Issue: 8 510 - 516 Pages

Abstract: Two new metal-based anticancer chemotherapeutic agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]- Cl.CH3OH.H2O 2, were designed, prepared and characterized by analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR) techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted octahedral and distorted trigonal-bipyramidal, respectively. Both 1 and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2 and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1 (2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible absorption studies suggest non-classical electrostatic mode of interaction via phosphate backbone of DNA double helix. The Stern- Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 × 106 M-1) determined by fluorescence studies suggests the groove binding and intercalation mode for 1 and 2, respectively. Effective cleavage of pBR322 DNA is induced by 1.Their interaction with DNA of cancer cells may account for potency.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Year: 2014 Volume: 8 Issue: 7 765 - 771 Pages

Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Low Power CNFET SRAM Design

Year: 2014 Volume: 8 Issue: 8 1281 - 1284 Pages

Abstract: CNFET has emerged as an alternative material to silicon for high performance, high stability and low power SRAM design in recent years. SRAM functions as cache memory in computers and many portable devices. In this paper, a new SRAM cell design based on CNFET technology is proposed. The proposed SRAM cell design for CNFET is compared with SRAM cell designs implemented with the conventional CMOS and FinFET in terms of speed, power consumption, stability, and leakage current. The HSPICE simulation and analysis show that the dynamic power consumption of the proposed 8T CNFET SRAM cell’s is reduced about 48% and the SNM is widened up to 56% compared to the conventional CMOS SRAM structure at the expense of 2% leakage power and 3% write delay increase.

Graphene Based Electronic Device

Year: 2014 Volume: 8 Issue: 8 1275 - 1280 Pages

Abstract: The semiconductor industry is placing an increased emphasis on emerging materials and devices that may provide improved performance, or provide novel functionality for devices. Recently, graphene, as a true two-dimensional carbon material, has shown fascinating applications in electronics. In this paper detailed discussions are introduced for possible applications of grapheme Transistor in RF and digital devices.

Keywords:
Graphene
GFET
RF
Digital.

Proactive Approach to Innovation Management

Year: 2014 Volume: 8 Issue: 7 2286 - 2290 Pages

Abstract: The focus of this paper is to compare common approaches for Systems of Innovation (SI) and identify proactive alternatives for driving the innovation. Proactive approaches will also consider short and medium term perspectives with developments in the field of Computer Technology and Artificial Intelligence. Concerning Computer Technology and Large Connected Information Systems, it is reasonable to predict that during current or the next century intelligence and innovation will be separated from the constraints of human driven management. After this happens, humans will be no longer driving the innovation and there is possibility that SI for new intelligent systems will set its own targets and exclude humans. Over long time scale these developments could result in scenario, which will lead to the development of larger, cross galactic (universal) proactive SI and Intelligence.

Lego Mindstorms as a Simulation of Robotic Systems

Year: 2014 Volume: 8 Issue: 7 1216 - 1220 Pages

Abstract: In this paper we deal with using Lego Mindstorms in simulation of robotic systems with respect to cost reduction. Lego Mindstorms kit contains broad variety of hardware components which are required to simulate, program and test the robotics systems in practice. Algorithm programming went in development environment supplied together with Lego kit as in programming language C# as well. Algorithm following the line, which we dealt with in this paper, uses theoretical findings from area of controlling circuits. PID controller has been chosen as controlling circuit whose individual components were experimentally adjusted for optimal motion of robot tracking the line. Data which are determined to process by algorithm are collected by sensors which scan the interface between black and white surfaces followed by robot. Based on discovered facts Lego Mindstorms can be considered for low-cost and capable kit to simulate real robotics systems.

Visual Identity Components of Tourist Destination

Year: 2014 Volume: 8 Issue: 7 2208 - 2212 Pages

Abstract: In the world of modern communications, visual identity has predominant influence on the overall success of tourist destinations, but despite of these, the problem of designing thriving tourist destination visual identity and their components are hardly addressed. This study highlights the importance of building and managing the visual identity of tourist destination, and based on the empirical study of well-known Mediterranean destination of Croatia analyses three main components of tourist destination visual identity; name, slogan, and logo. Moreover, the paper shows how respondents perceive each component of Croatia’s visual identity. According to study, logo is the most important, followed by the name and slogan. Research also reveals that Croatian economy lags behind developed countries in understanding the importance of visual identity, and its influence on marketing goal achievements.

Reliability-Based Life-Cycle Cost Model for Engineering Systems

Year: 2014 Volume: 8 Issue: 7 1265 - 1270 Pages

Abstract: The effect of reliability on life-cycle cost, including initial and maintenance cost of a system is studied. The failure probability of a component is used to calculate the average maintenance cost during the operation cycle of the component. The standard deviation of the life-cycle cost is also calculated as an error measure for the average life-cycle cost. As a numerical example, the model is used to study the average life-cycle cost of an electric motor.

Employee Aggression, Labeling and Emotional Intelligence

Year: 2014 Volume: 8 Issue: 7 2189 - 2192 Pages

Authors:
Martin Popescu D. Dana Maria

Abstract: The aims of this research are to broaden the study on the relationship between emotional intelligence and counterproductive work behavior (CWB). The study sample consisted in 441 Romanian employees from companies all over the country. Data has been collected through web surveys and processed with SPSS. The results indicated an average correlation between the two constructs and their sub variables, employees with a high level of emotional intelligence tend to be less aggressive. In addition, labeling was considered an individual difference which has the power to influence the level of employee aggression. A regression model was used to underline the importance of emotional intelligence together with labeling as predictors of CWB. Results have shown that this regression model enforces the assumption that labeling and emotional intelligence, taken together, predict CWB. Employees, who label themselves as victims and have a low degree of emotional intelligence, have a higher level of CWB.

The New Approach to Airport Emergency Plans

Year: 2014 Volume: 8 Issue: 8 2528 - 2531 Pages

Abstract: This article deals with a new approach to the airport emergency plans, which are the basic documents and manuals for dealing with events with impact on safety or security. The article describes the identified parts in which the current airport emergency plans do not fulfill their role and which should therefore be considered in the creation of corrective measures. All these issues have been identified at airports in the Czech Republic and confirmed at airports in neighboring countries.

DNA Methylation Changes Caused by Lawsone

Year: 2014 Volume: 8 Issue: 7 699 - 702 Pages

Abstract: Lawsone is a pigment that occurs naturally in plants. It has been used as a skin and hair dye for a long time. Moreover, its different biological activities have been reported. The present study focused on the effect of lawsone on a plant cell model represented by tobacco BY-2 cell suspension culture, which is used as a model comparable with the HeLa cells. It has been shown that lawsone inhibits the cell growth in the concentration-dependent manner. In addition, changes in DNA methylation level have been determined. We observed decreasing level of DNA methylation in the presence of increasing concentrations of lawsone. These results were accompanied with overproduction of reactive oxygen species (ROS). Since epigenetic modifications can be caused by different stress factors, there could be a connection between the changes in the level of DNA methylation and ROS production caused by lawsone.

Top Journal

SUGGEST A JOURNAL