Abstract: Taro Scarab beetles (Papuana uninodis, Coleoptera:
Scarabaeidae) inflict severe damage on important root crops and
plants such as Taro or Cocoyam, yam, sweet potatoes, oil palm and
coffee tea plants across Africa and Asia resulting in economic
hardship and starvation in some nations. Scoliid wasps and
Metarhizium anisopliae fungus - bio-control agents; are shown to be
able to control the population of Scarab beetle adults and larvae using
a newly created simulation model based on non-linear ordinary
differential equations that track the populations of the beetle life
cycle stages: egg, larva, pupa, adult and the population of the scoliid
parasitoid wasps, which attack beetle larvae. In spite of the challenge
driven by the longevity of the scarab beetles, the combined effect of
the larval wasps and the fungal bio-control agent is able to control
and drive down the population of both the adult and the beetle eggs
below the environmental carrying capacity within an interval of 120
days, offering the long term prospect of a stable and eco-friendly
environment; where the population of scarab beetles is: regulated by
parasitoid wasps and beneficial soil saprophytes.
Abstract: This paper is about method to produce a stable and
accurate constant output pulse width regardless of the amplitude,
period and pulse width variation of the input signal source. The pulse
generated is usually being used in numerous applications as the
reference input source to other circuits in the system. Therefore, it is
crucial to produce a clean and constant pulse width to make sure the
system is working accurately as expected.
Abstract: Enzyme activity was evaluated in the intestine of
juvenile dourado (Salminus brasiliensis) fed with diets containing 0,
10 or 20% of lyophilized bovine colostrum (LBC) inclusion for either
30 or 60 days. The intestinal enzymes acid and alkaline phosphatase
(ACP and ALP, respectively), non-specific esterase (NSE), lipase
(LIP), dipeptidyl aminopeptidase IV (DAP IV) and leucine
aminopeptidase (LAP) were studied using histochemistry in four
intestinal segments (S1, S2, S3 and posterior intestine). Weak
proteolitic activity was observed in all intestinal segments for DAP
IV and LAP. The activity of NSE and LIP was also weak in all
intestines, except for the moderate activity of NSE in the S2 of 20%
LBC group after 30 days and in the S1 of 0% LBC group after 60
days. The ACP was detected only in the S2 and S3 of the 10% LBC
group after 30 days. Moderate and strong staining was observed in
the first three intestinal segments for ALP and weak activity in the
posterior intestine. The activity of DAP IV, LAP and ALP were also
present in the cytoplasm of the enterocytes. In the present results,
bovine colostrum feeding did not cause alterations in activity of
intestinal enzymes.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In review the generalized data about different methods of synthesis of biological activity acylatedhydrohyanthraquinones is presented. The basic regularity of a synthesis is analyzed. Action of temperature, pH, solubility, catalysts and other factors on a reaction product yield is revealed.
Abstract: The MyD88 is an evolutionarily conserved host-expressed adaptor protein that is essential for proper TLR/ IL1R immune-response signaling. A previously identified complete cDNA (1626 bp) of OfMyD88 comprised an ORF of 867 bp encoding a protein of 288 amino acids (32.9 kDa). The gDNA (3761 bp) of OfMyD88 revealed a quinquepartite genome organization composed of 5 exons (with the sizes of 310, 132, 178, 92 and 155 bp) separated by 4 introns. All the introns displayed splice signals consistent with the consensus GT/AG rule. A bipartite domain structure with two domains namely death domain (24-103) coded by 1st exon, and TIR domain (151-288) coded by last 3 exons were identified through in silico analysis. Moreover, homology modeling of these two domains revealed a similar quaternary folding nature between human and rock bream homologs. A comprehensive comparison of vertebrate MyD88 genes showed that they possess a 5-exonic structure.In this structure, the last three exons were strongly conserved, and this suggests that a rigid structure has been maintained during vertebrate evolution.A cluster of TATA box-like sequences were found 0.25 kb upstream of cDNA starting position. In addition, putative 5'-flanking region of OfMyD88 was predicted to have TFBS implicated with TLR signaling, including copies of NFkB1, APRF/ STAT3, Sp1, IRF1 and 2 and Stat1/2. Using qPCR technique, a ubiquitous mRNA expression was detected in liver and blood. Furthermore, a significantly up-regulated transcriptional expression of OfMyD88 was detected in head kidney (12-24 h; >2-fold), spleen (6 h; 1.5-fold), liver (3 h; 1.9-fold) and intestine (24 h; ~2-fold) post-Fla challenge. These data suggest a crucial role for MyD88 in antibacterial immunity of teleosts.
Abstract: This research aimed to study form of traffic distribution and environmental factors of road that affect traffic accidents in Dusit District, only areas responsible of Samsen Police Station. Data used in this analysis is the secondary data of traffic accident case from year 2011. Observed area units are 15 traffic lines that are under responsible of Samsen Police Station. Technique and method used are the Cartographic Method, the Correlation Analysis, and the Multiple Regression Analysis. The results of form of traffic accidents show that, the Samsen Road area had most traffic accidents (24.29%), second was Rachvithi Road(18.10%), third was Sukhothai Road (15.71%), fourth was Rachasrima Road (12.38%), and fifth was Amnuaysongkram Road(7.62%). The result from Dusit District, onlyareasresponsibleofSamsen police station, has suggested that the scale of accidents have high positive correlation with statistic significant at level 0.05 and the frequency of travel (r=0.857). Traffic intersection point (r=0.763)and traffic control equipments (r=0.713) are relevant factors respectively. By using the Multiple Regression Analysis, travel frequency is the only one that has considerable influences on traffic accidents in Dusit district only Samsen Police Station area. Also, a factor in frequency of travel can explain the change in traffic accidents scale to 73.40 (R2 = 0.734). By using the Multiple regression summation from analysis was Ŷ=-7.977+0.044X6
Abstract: Montmorillonite (MMT) is a very abundant clay mineral and is versatile such that it can be chemically or physically altered by changing the ions between the sheets of its layered structure. This clay mineral can be prepared into functional nanoparticles that can be used as fillers in other nanomaterials such as nanofibers to achieve special properties. In this study, two types of iron-modified MMT, Iron-MMT (FeMMT) and Zero Valent Iron-MMT (ZVIMMT) were synthesized via ion exchange technique. The modified clay was incorporated in polymer nanofibers which were produced using a process called electrospinning. ICP analysis confirmed that clay modification was successful where there is an observed decrease in the concentration of Na and an increase in the concentration of Fe after ion exchange. XRD analysis also confirmed that modification took place because of the changes in the d-spacing of Na-MMT from 11.5 Å to 13.6 Å and 12.6 Å after synthesis of FeMMT and ZVIMMT, respectively. SEM images of the electrospun nanofibers revealed that the ZVIMMT-filled fibers have a smaller average diameter than the FeMMT-filled fibers because of the lower resistance of the suspensions of the former to the elongation force from the applied electric field. The resistance to the electric field was measured by getting the bulk voltage of the suspensions.
Abstract: Rice grain is Sierra Leone’s staple food and the nation
imports over 120,000 metric tons annually due to a shortfall in its
cultivation. Thus, the insufficient level of the crop's cultivation in
Sierra Leone is caused by many problems and this led to the
endlessly widening supply and demand for the crop within the
country. Consequently, this has instigated the government to spend
huge money on the importation of this grain that would have been
otherwise cultivated domestically at a cheaper cost. Hence, this
research attempts to explore the response of rice supply with respect
to its demand in Sierra Leone within the period 1980-2010.
The Nerlovian adjustment model to the Sierra Leone rice data set
within the period 1980-2010 was used. The estimated trend equations
revealed that time had significant effect on output, productivity
(yield) and area (acreage) of rice grain within the period 1980-2010
and this occurred generally at the 1% level of significance. The
results showed that, almost the entire growth in output had the
tendency to increase in the area cultivated to the crop. The time trend
variable that was included for government policy intervention
showed an insignificant effect on all the variables considered in this
research. Therefore, both the short-run and long-run price response
was inelastic since all their values were less than one.
From the findings above, immediate actions that will lead to
productivity growth in rice cultivation are required.
To achieve the above, the responsible agencies should provide
extension service schemes to farmers as well as motivating them on
the adoption of modern rice varieties and technology in their rice
cultivation ventures.
Abstract: The goal of this study was to increase the awareness of the description and assessments of rice acreage response and to offer mechanisms for agricultural policy scrutiny. The ordinary least square (OLS) technique was utilized to determine the coefficients of acreage response models for the rice varieties. The magnitudes of the coefficients (λ) of both the ROK lagged and NERICA lagged acreages were found positive and highly significant, which indicates that farmers’ adjustment rate was very low. Regarding lagged actual price for both the ROK and NERICE rice varieties, the short-run price elasticitieswere lower than long-run, which is suggesting a long term adjustment of the acreage under the crop.
However, the apparent recommendations for policy transformation are to open farm gate prices and to decrease government’s involvement in agricultural sector especially in the acquisition of agricultural inputs. Impending research have to be centered on how this might be better realized. Necessary conditions should be made available to the private sector by means of minimizing price volatility. In accordance with structural reforms, it is necessary to convey output prices to farmers with minimum distortion. There is need to eradicate price subsidies and control, which generate distortion in the market in addition to huge financial costs.
Abstract: MicroRNAs (miRNAs), a class of approximately 22 nucleotide long non coding RNAs which play critical role in different biological processes. The mature microRNA is usually 19–27 nucleotides long and is derived from a bigger precursor that folds into a flawed stem-loop structure. Mature micro RNAs are involved in many cellular processes that encompass development, proliferation, stress response, apoptosis, and fat metabolism by gene regulation. Resent finding reveals that certain viruses encode their own miRNA that processed by cellular RNAi machinery. In recent research indicate that cellular microRNA can target the genetic material of invading viruses. Cellular microRNA can be used in the virus life cycle; either to up regulate or down regulate viral gene expression Computational tools use in miRNA target prediction has been changing drastically in recent years. Many of the methods have been made available on the web and can be used by experimental researcher and scientist without expert knowledge of bioinformatics. With the development and ease of use of genomic technologies and computational tools in the field of microRNA biology has superior tremendously over the previous decade. This review attempts to give an overview over the genome wide approaches that have allow for the discovery of new miRNAs and development of new miRNA target prediction tools and databases.
Abstract: A simple, rapid and non-invasive electromagnetic sensor (C-FAST device) was- patented; for diagnosis of HCV RNA. Aim: To test the validity of the device compared to standard HCV PCR. Subjects and Methods: The first phase was done as pilot in Egypt on 79 participants; the second phase was done in five centers: one center from Egypt, two centers from Pakistan and two centers from India (800, 92 and 113 subjects respectively). The third phase was done nationally as multicenter study on (1600) participants for ensuring its representativeness. Results: When compared to PCR technique, C-FAST device revealed sensitivity 95% to 100%, specificity 95.5% to 100%, PPV 89.5% to 100%, NPV 95% to 100% and positive likelihood ratios 21.8% to 38.5%. Conclusion: It is practical evidence that HCV nucleotides emit electromagnetic signals that can be used for its identification. As compared to PCR, C-FAST is an accurate, valid and non-invasive device.
Abstract: The Salman Farsi dam project is constructed on the Ghareh Agahaj River about 140km south of Shiraz city in the Zagros Mountains of southwestern Iran. This tectonic province of south-western Iran is characterized by a simple folded sedimentary sequence. The dam foundation rocks compose of the Asmari Formation of Oligo-miocene and generally comprise of a variety of karstified carbonate rocks varying from strong to weak rocks. Most of the rocks exposed at the dam site show a primary porosity due to incomplete diagenetic recrystallization and compaction. In addition to these primary dispositions to weathering, layering conditions (frequency and orientation of bedding) and the subvertical tectonic discontinuities channeled preferably the infiltrating by deep-sited hydrothermal solutions. Consequently the porosity results to be enlarged by dissolution and the rocks are expected to be karstified and to develop cavities in correspondence of bedding, major joint planes and fault zones. This kind of karsts is named hypogenic karsts which associated to the ascendant warm solutions. Field observations indicate strong karstification and vuggy intercalations especially in the middle part of the Asmari succession. The biggest karst in the dam axis which identified by speleological investigations is Golshany Cave with volume of about 150,000 m3. The tendency of the Asmari limestone for strong dissolution can alert about the seepage from the reservoir and area of the dam locality.
Abstract: The speed profiles, gas holdup (eG) and global oxygen transfer coefficient (kLa) from a stirred airlift bioreactor using water as the fluid model, was investigated by computational fluid dynamics modeling. The parameters predicted by the computer model were validated with the experimental dates. The CFD results were very close to those obtained experimentally. During the simulation it was verified a prevalent impeller effect at low speeds, propelling a large volume of fluid against the walls of the vessel, which without recirculation, results in low values of eG and kLa; however, by increasing air velocity, the impeller effect is smaller with the air flow being greater, in the region of the riser, causing fluid recirculation, which explains the increase in eG and kLa.
Abstract: The AEC sector has an expressive environmental responsibility. Actually, most building materials have severe environmental impacts along their production cycle. Professionals enrolled in building design may choice the materials and techniques with less impact among the viable options. This work presents a study about embodied energy in materials of two typical Brazilian constructive alternatives. The construction options considered are reinforced concrete structure and structural masonry. The study was developed for the region of São Leopoldo, southern Brazil. Results indicated that the energy embodied in these two constructive systems is approximately 1.72 GJ·m-2 and 1.26 GJ·m-2, respectively. It may be concluded that the embodied energy is lower in the structural masonry system, with a reduction around to 1/4 in relation to the traditional option. The results can be used to help design decisions.
Abstract: In this study sugarcane field soils with a long history of atrazine application in Chachoengsao and Chonburi provinces have been explored for their potential of atrazine biodegradation. For the atrazine degrading bacteria isolation, the soils used in this study named ACS and ACB were inoculated in MS-medium containing atrazine. Six short rod and gram-negative bacterial isolates, which were able to use this herbicide as a sole source of nitrogen, were isolated and named as ACS1, ACB1, ACB3, ACB4, ACB5 and ACB6. From the 16S rDNA nucleotide sequence analysis, the isolated bacteria ACS1 and ACB4 were identified as Rhizobium sp. with 89.1-98.7% nucleotide identity, ACB1 and ACB5 were identified as Stenotrophomonas sp. with 91.0-92.8% nucleotide identity, whereas ACB3 and ACB6 were Klebsiella sp. with 97.4-97.8% nucleotide identity.
Abstract: Infectious bronchitis virus (IBV) is a very dynamic and evolving virus, causing major economic losses to the global poultry industry. Recently, the Libyan poultry industry faced severe outbreak of respiratory distress associated with high mortality and dramatic drop in egg production. Tracheal and cloacal swabs were analyzed for several poultry viruses. IBV was detected using SYBR Green I real-time PCR detection based on the nucleocapsid (N) gene. Sequence analysis of the partial N gene indicated high similarity (~ 94%) to IBV strain 3382/06 that was isolated from Taiwan. Even though the IBV strain 3382/06 is more similar to that of the Mass type H120, the isolate has been implicated associated with intertypic recombinant of 3 putative parental IBV strains namely H120, Taiwan strain 1171/92 and China strain CK/CH/LDL/97I. Complete sequencing and antigenicity studies of the Libya IBV strains are currently underway to determine the evolution of the virus and its importance in vaccine induced immunity. In this paper we documented for the first time the presence of possibly variant IBV strain from Libya which required dramatic change in vaccination program.
Abstract: Restructuring of Electricity supply industry introduced many issues such as transmission pricing, transmission loss allocation and congestion management. Many methodologies and algorithms were proposed for addressing these issues. In this paper a power flow tracing based method is proposed which involves Matrices methodology for the transmission usage and loss allocation for generators and demands. This method provides loss allocation in a direct way because all the computation is previously done for usage allocation. The proposed method is simple and easy to implement in a large power system. Further it is less computational because it requires matrix inversion only a single time. After usage and loss allocation cooperative game theory is applied to results for finding efficient economic signals. Nucleolus and Shapely value approach is used for optimal allocation of results. Results are shown for the IEEE 6 bus system and IEEE 14 bus system.
Abstract: Using calculated phase- shift values, for pp, nn, and np elastic scattering in the energy range 1MeV to 350MeV, the charge independence breaking of nucleon-nucleon interaction is investigated. We have used Darboux transformation to calculate phase-shift for the first three values of
Abstract: The bound state energy of three quark systems is studied in the framework of a non- relativistic spin independent phenomenological model. The hyper- spherical coordinates are considered for the solution this system. According to Jacobi coordinate, we determined the bound state energy for (uud) and (ddu) quark systems, as quarks are flavorless mass, and it is restrict that choice potential at low and high range in nucleon bag for a bound state.