Abstract: A landing pier is subjected to safety assessment by visual inspection and design data, but it is difficult to check the damage in real-time. In this study, real - time damage detection and safety evaluation methods were studied. As a result of structural analysis of the arbitrary landing pier structure, the inflection point of deformation and moment occurred at 10%, 50%, and 90% of pile length. The critical value of Fiber Bragg Grating (FBG) sensor was set according to the safety factor, and the FBG sensor application method for real - time safety evaluation was derived.
Abstract: Sustainable development is one of the most important topics in today's world, and it is also an important research topic for geoenvironmental engineering. Dredging process is performed to expand the river and port channel, flood control and accessing harbors. Every year large amount of sediment are dredged for these purposes. Dredged marine soils can be reused as filling materials, road and foundation embankments, construction materials and wildlife habitat developments. In this study, geotechnical engineering properties and compressibility behavior of dredged soil obtained from the Izmir Bay were investigated. The samples with four different organic matter contents were obtained and particle size distributions, consistency limits, pH and specific gravity tests were performed. The consolidation tests were conducted to examine organic matter content (OMC) effects on compressibility behavior of dredged soil. This study has shown that the OMC has an important effect on the engineering properties of dredged soils. The liquid and plastic limits increased with increasing OMC. The lowest specific gravity belonged to sample which has the maximum OMC. The specific gravity values ranged between 2.76 and 2.52. The maximum void ratio difference belongs to sample with the highest OMC (De11% = 0.38). As the organic matter content of the samples increases, the change in the void ratio has also increased. The compression index increases with increasing OMC.
Abstract: The objective of this study is to determine the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) harboring mecA genes from screening isolates among intensive care unit (ICU) patients. All MRSA screening isolates from ICU’s patients of Cipto Mangunkusumo Hospital during 2011 and 2014 were included in this study. Identification and susceptibility test was performed using Vitek2 system (Biomereux®). PCR was conducted to characterize the SCCmec of S. aureus harboring the mecA gene on each isolate. Patient’s history of illness was traced through medical record. 24 isolates from 327 screening isolates were MRSA positive (7.3%). From PCR, we found 17 (70.8%) isolates carrying SCCmec type I, 3 (12.5%) isolates carrying SCCmec type III, and 2 (8.3%) isolates carrying SCCmec type IV. In conclusion, SCCmec type I is the most prevalent MRSA colonization among ICU patients in Cipto Mangunkusumo Hospital.
Abstract: During the interwar period artificial materials were often preferred, but many Antwerp architects relied on the application of wood for most of the interior finishing works and furnishings. Archival, literature and on site research of interwar suburban townhouses and the Belgian wood and furniture industry gave a new insight to the application of wood in the interwar interior. Many interwar designers favored the decorative values in all treatments of wood because of its warmth, comfort, good-wearing, and therefore, economic qualities. For the creation of a successful modern interior the texture and surface of the wood becomes as important as the color itself. This aesthetics valuation was the result of the modernization of the wood industry. The development of veneer and plywood gave the possibility to create strong, flat, long and plain wooden surfaces which are capable of retaining their shape. Also the modernization of cutting machines resulted in high quality and diversity in texture of veneer. The flat and plain plywood surfaces were modern decorated with all kinds of veneer-sliced options. In addition, wood species from the former Belgian Colony Congo were imported. Limba (Terminalia superba), kambala (Chlorophora excelsa), mubala (Pentaclethra macrophylla) and sapelli (Entandrophragma cylindricum) were used in the interior of many Antwerp interwar suburban town houses. From the thirties onwards Belgian wood firms established modern manufactures in Congo. There the local wood was dried, cut and prepared for exportation to the harbor of Antwerp. The presence of all kinds of strong and decorative Congolese wood products supported its application in the interwar interior design. The Antwerp architects combined them in their designs for doors, floors, stairs, built-in-furniture, wall paneling and movable furniture.
Abstract: Over recent years much progress has been achieved in the fields of numerical modeling shoreline processes: waves, currents, waves and current. However, there are still some problems in the existing models to link the on the first, the hydrodynamics of waves and currents and secondly, the sediment transport processes and due to the variability in time, space and interaction and the simultaneous action of wave-current near the shore. This paper is the establishment of a numerical modeling to forecast the sediment transport from development scenarios of harbor structure. It is established on the basis of a numerical simulation of a water-sediment model via a 2D model using a set of codes calculation MIKE 21-DHI software. This is to examine the effect of the sediment transport drivers following the dominant incident wave in the direction to pass input harbor work under different variants planning studies to find the technical and economic limitations to the sediment transport and protection of the harbor structure optimum solution.
Abstract: The purpose of this study is to investigate the efficacy of the solution-focused brief therapy on improving the psychological wellbeing of family supervisor woman. This study has been carried out by semi-experimental method and in the form of pre-test, post-test performance on two groups (experimental and control), so that one sample group of 30 individuals was randomly achieved and were randomly divided in two groups of experimental (n=15) and control (n=15). To collect data, Ryff scale psychological wellbeing was used. After conducting pre-test (RSPWB) for two experimental and control groups, Solution-focused brief therapy interference was conducted on the experimental group during five two-hour sessions. Finally, Ryff scale psychological wellbeing was reused for the two groups as post-test and achieved outcomes that were analyzed using covariance. The results indicated that the significant increase of average marks of the experimental group in psychological wellbeing had better function than that of the control group. Finally, solution-focused brief therapy for improving psychological well-being of family supervisor women has a suitable capability and could be used in this way.
Abstract: The research on “The Way of Life of the Civil Servant
Community under the Bureau of the Royal Household” aims to study
1) the way of life of the people who live in the civil servant
community in Tha Wasukri, and 2) the model of community
administration of civil servants under the Bureau of the Royal
Household. This research is conducted qualitatively and
quantitatively by collecting data from interviews, focus group
discussion, participant and non-participant observation along with the
data from questionnaire based on age groups which include elder
group, working age group and youth group.
The result of the research shows that the origin of this community
is related to the history during the Rama V’s reign. It has been a
harbor for the king to boat in any royal ceremonies; this custom is
still maintained until today. The status or position of person who
serves the king in terms of working is often inherited from the bureau
of the Royal Household based on his/her consanguinity and, hence,
further receives the rights to live in the Tha Wasukri area. Therefore,
this community has some special characteristics demonstrating the
way of living influenced by the regulation of the Bureau of the Royal
Household such as respecting elders and interdependence in which
there is internal social organization with the practice of bureaucracy
in going in and out the community. The person who has rights to live
here must be friendly to everybody so that this community will be a
safe place for lives and property. The administration based on the
model of Bangkok for local administration was used as an external
structure only, but the way of living still follows the practice of the
Bureau of the Royal Household.
Abstract: The Roma (Gypsies) is a transnational minority with a
high degree of consanguineous marriages. Similar to other
genetically isolated founder populations, the Roma harbor a number
of unique or rare genetic disorders. This paper discusses about a rare
form of Charcot-Marie-Tooth disease – type 4G (CMT4G), also
called Hereditary Motor and Sensory Neuropathy type Russe, an
autosomal recessive disease caused by mutation private to Roma
characterized by abnormally increased density of non-myelinated
axons. CMT4G was originally found in Bulgarian Roma and in 2009
two putative causative mutations in the HK1 gene were identified.
Since then, several cases were reported in Roma families mainly
from Bulgaria and Spain. Here we present a Slovak Roma family in
which CMT4G was diagnosed on the basis of clinical examination
and genetic testing. This case is a further proof of the role of the HK1
gene in pathogenesis of the disease. It confirms that mutation in the
HK1 gene is a common cause of autosomal recessive CMT disease in
Roma and should be considered as a common part of a diagnostic
procedure.
Abstract: The Port of Townsville conducts regular annual
maintenance dredging to maintain depths of its harbor basin and
approach channels for the navigational safety of the vessels against
the natural accumulation of marine sediments. In addition to the
regular maintenance dredging, the port undertakes emergency
dredging in cases where large quantities of sediments are mobilized
and deposited in port waters by cyclone or major flood events. The
maintenance dredging material derived from the port may be
disposed at sea or on land in accordance with relevant state and
commonwealth regulations. For the land disposal, the dredged mud
slurry is hydraulically placed into containment ponds and left to
undergo sedimentation and self-weight consolidation to form fill
material for land reclamation. This paper provides an overview of the
maintenance dredging at the Port of Townsville and emphasis on
maintenance dredging requirements, sediment quality, bathymetry,
dredging methods used, and dredged material disposal options.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Microbial air contamination of the outdoor air in Marine Durres-s Harbour (Durres, Albania) was estimated by sedimentation technique in August-October 2008. The sampling areas were: Ferry Terminal (FT), Fishery Harbor (FH), East Zone (EZ), Fuel Quay (FQ) and Apollonian Beach (AB). The aim of this study was to measure the number of aerobic plate count (mesophilic aerobic bacteria) and fungi (yeasts and molds) in the outdoor air in these areas. The number of colonies that were formed determines the number of cells at the moment in the outdoor air; respectively the number of mesophilic aerobic bacteria and yeasts and molds. The measure of bacteria and fungi used is CFU (Colony Forming Units) per Petri dish. It is said that marine harbours are very polluted areas. The aim of study was the definition of mesophilic aerobic bacteria and yeasts and molds number, and the comparison of microorganisms number in air sampling areas.
Abstract: This study was conducted using the data collected at the mouth of Jen-Gen River to investigate and analyze chromium (Cr) contained in the sediments, and to evaluate the accumulation of Cr and the degree of its potential risk. The results show that samples collected at all monitoring stations near the mouth of Jen-Gen River contain 92–567 mg/kg of Cr with average of 366±166 mg/kg. The spatial distribution of Cr reveals that the Cr concentration is relatively high in the river mouth region, and gradually diminishes toward the harbor region. This indicates that upstream industrial and municipal wastewater discharges along the river bank are major sources of pollution. The accumulation factor and potential ecological risk index indicate that the sedimentation at Jen-Gen River mouth has the most serious degree of Cr accumulation and the highest ecological potential risk.
Abstract: The research is to minimize environmental damage
pertinent to maritime activities about the operation of lighter boat
anchorage and its tugboat. The guidance on upgrading current
harbor service and infrastructure has been provided to Kho Sichang
Municpality. This will involve a study of the maritime logistics of
the water area under jurisdiction of the Sichang island Municipality
and possible recommendations may involve charging taxes,
regulations and fees. With implementing these recommendations will
help in protection of the marine environment and in increasing
operator functionality. Additionally, our recommendation is to
generate a consistent revenue stream to the municipality. The action
items contained in this research are feasible and effective, the success
of these initiatives are heavily dependent upon successful promotion
and enforcement. Promoting new rules and regulations effectively
and peacefully can be done through theories and techniques used in
the psychology of persuasion. In order to assure compliance with the
regulations, the municipality must maintain stringent patrols and
fines for violators. In order to become success, the Municipality
must preserve a consistent, transparent and significant enforcement
system. Considering potential opportunities outside of the current
state of the municipality, the authors recommend that Koh Sichang be
given additional jurisdiction to capture value from the master vessels,
as well as to confront the more significant environmental challenges
these vessels pose. Finally, the authors recommend that the Port of
Koh Sichang Island obtain a free port status in order to increase
economic viability and overall sustainability.
Abstract: Surface sediment samples were collected from the
Canon River mouth, Taiwan and analyzed for polycyclic aromatic
hydrocarbons (PAHs). Total PAHs concentrations varied from 337 to
1,252 ng/g dry weight, with a mean concentration of 827 ng/g dry
weight. The spatial distribution of PAHs reveals that the PAHs
concentration is relatively high in the river mouth region, and
gradually diminishes toward the harbor region. Diagnostic ratios
showed that the possible source of PAHs in the Canon River mouth
could be petroleum combustion. The toxic equivalent concentrations
(TEQcarc) of PAHs varied from 47 to 112 ng TEQ/g dry weight. Higher
total TEQcarc values were found in the river mouth region. As
compared with the US Sediment Quality Guidelines (SQGs), the
observed levels of PAHs at Canon River mouth were lower than the
effects range low (ERL), and would probably not exert adverse
biological effects.
Abstract: The distribution, enrichment, accumulation, and potential ecological risk of copper (Cu) in the surface sediments of northern Kaohsiung Harbor, Taiwan were investigated. Sediment samples from 12 locations of northern Kaohsiung Harbor were collected and characterized for Cu, aluminum, water content, organic matter, total nitrogen, total phosphorous, total grease and grain size. Results showed that the Cu concentrations varied from 6.9–244 mg/kg with an average of 109±66 mg/kg. The spatial distribution of Cu reveals that the Cu concentration is relatively high in the river mouth region, and gradually diminishes toward the harbor entrance region. This indicates that upstream industrial and municipal wastewater discharges along the river bank are major sources of Cu pollution. Results from the enrichment factor and geo-accumulation index analyses imply that the sediments collected from the river mouth can be characterized between moderate and moderately severe degree enrichment and between none to medium and moderate accumulation of Cu, respectively. However, results of potential ecological risk index indicate that the sediment has low ecological potential risk.
Abstract: Abstract–The objectives of the current study are to determine the
prevalence, etiological agents, drug susceptibility pattern and plasmid
profile of Acinetobacter baumannii isolates from Hospital-Acquired
Infections (HAI) at Community Hospital, Al Jouf Province, Saudi
Arabia. A total of 1890 patients had developed infection during
hospital admission and were included in the study. Among those who
developed nosocomial infections, 15(9.4), 10(2.7) and 118 (12.7) had
respiratory tract infection (RTI), blood stream infections (BSI) and
urinary tract (UTI) respectively. A total of 268 bacterial isolates were
isolated from nosocomial infection. S. aureus was reported in 23.5%
for of the total isolates followed by Klebsiella pneumoniae (17.5%), E.
coli (17.2%), P. aeruginosa (11.9%), coagulase negative
staphylococcus (9%), A. baumannii (7.1%), Enterobacter spp.
(3.4%), Citrobacter freundii (3%), Proteus mirabilis (2.6%), and
Proteus vulgaris and Enterococcous faecalis (0.7%). Isolated
organisms are multi-drug resistant, predominantly Gram-positive
pathogens with a high incidence of methicillin-resistant S. aureus,
extended spectrum beta lactamase and vancomycin resistant
enterococci organisms. The RFLP (Fragment Length Polymorphisms)
patterns of plasmid preparations from isolated A. baumannii isolates
had altered RFLP patterns, possibly due to the presence of plasmid(s).
Five A. baumannii isolates harbored plasmids all of which were not
less than 2.71kbp in molecular weight. Hence, it showed that the gene
coding for the isolates were located on the plasmid DNA while the
remaining isolates which have no plasmid might showed gene coding
for antibiotic resistance being located on chromosomal DNA.
Nosocomial infections represent a current problem in Community
Hospital, Al Jouf Province, Saudi Arabia. Problems associated with
SSI include infection with multidrug resistant pathogens which are
difficult to treat and are associated with increased mortality.
Abstract: The distribution, enrichment, and accumulation of zinc
(Zn) in the sediments of Kaohsiung Ocean Disposal Site (KODS),
Taiwan were investigated. Sediment samples from two outer disposal
site stations and nine disposed stations in the KODS were collected per
quarterly in 2009 and characterized for Zn, aluminum, organic matter,
and grain size. Results showed that the mean Zn concentrations varied
from 48 mg/kg to 456 mg/kg. Results from the enrichment factor (EF)
and geo-accumulation index (Igeo) analyses imply that the sediments
collected from the KODS can be characterized between moderate and
moderately severe degree enrichment and between none and none to
medium accumulation of Zn, respectively. However, results of
potential ecological risk index indicate that the sediment has low
ecological potential risk. The EF, Igeo, and Zn concentrations at the
disposed stations were slightly higher than those at outer disposal site.
This indicated that the disposed area centers may be subjected to the
disposal impaction of harbor dredged sediments.
Abstract: Two indica varieties, IR36 and ‘Suweon 258’ (“S”)
are middle-heading in southern Japan. 36U, also middle-heading, is
an isogenic line of IR36 carrying Ur1 (Undulate rachis-1) gene.
However, late-heading plants segregated in the F2 population from
the F1 of S × 36U, and so did in the following generations. The
concerning lateness gene is designated as Ex. From the F8 generation,
isogenic-line pair of early-heading and late-heading lines, denoted by
“E” (ex/ex) and “L” (Ex/Ex), were developed. Genetic analyses of
heading time were conducted, using F1s and F2s among L, E, S and
36U. The following inferences were drawn from the experimental
results: 1) L, and both of E and 36U harbor Ex and ex, respectively;
2) Besides Ex, S harbors an inhibitor gene to it, i.e. I-Ex which is a
novel finding of the present study. 3) Ex is a dominant allele at the
E1 locus.