Abstract: Amyloid aggregation of polypeptides is related to a
growing number of pathologic states known as amyloid disorders. In
recent years, blocking or reversing amyloid aggregation via the use of
small compounds are considered as two useful approaches in
hampering the development of these diseases. In this research, we
have compared the ability of several manganese-salen derivatives, as
synthetic compounds, and apigenin, as a natural flavonoid, to inhibit
of hen egg-white lysozyme (HEWL) aggregation, as an in vitro
model system.
Different spectroscopic analyses such as Thioflavin T (ThT) and
Anilinonaphthalene-8-sulfonic acid (ANS) fluorescence, Congo red
(CR) absorbance along with transmission electron microscopy were
used in this work to monitor the HEWL aggregation kinetic and
inhibition. Our results demonstrated that both type of compounds
were capable to prevent the formation of lysozyme amyloid
aggregation in vitro. In addition, our data indicated that synthetic
compounds had higher activity to inhibit of the β-sheet structures
relative to natural compound. Regarding the higher antioxidant
activities of the salen derivatives, it can be concluded that in addition
to aromatic rings of each of the compounds, the potent antioxidant
properties of salen derivatives contributes to lower lysozyme fibril
accumulation.
Abstract: The use of low quality concrete has been identified as one of the main causes of the incessant collapse of buildings in Nigeria. Emphasis has been on the use of poor quality aggregates, poor workmanship and the use of lean concrete mix with low cement quantity as the reasons for the low quality of concrete used for building construction in Nigeria. Surveys conducted revealed that in the construction of most privately owned buildings where concrete trial mixes and concrete compressive strength quality assurance tests are not conducted, concretes used for building constructions are produced using the 1:2:4 mix ratio irrespective of the cement grade/strength class. In this paper, the possible role of the use of inappropriate cement grade/strength class as a cause of the incessant collapse of building in Nigeria is investigated. Investigation revealed that the compressive strengths of concrete cubes produced with Portland-limestone cement grade 32.5 using 1:2:4 and 1:1.5:3 mix ratios are less than the 25MPa and 30MPa cube strengths generally recommended for building superstructures and foundations respectively. Conversely, the compressive strengths of concrete cubes produced with Portland-limestone cement grade 42.5 using 1:2:4 and 1:1.5:3 mix ratios exceed the 25MPa and 30MPa generally recommended for building superstructures and foundations respectively. Thus, it can be concluded that the use of inappropriate cement grade (Portland-limestone cement grade 32.5), particularly for the construction of building foundations is a potential cause of the incessant collapse of buildings in Nigeria. It is recommended that the Standards Organisation of Nigeria should embark on creating awareness for Nigerians, particularly, the home owners and the roadside craftsmen that Portland-limestone cement grade 32.5 should not be used for the construction of building load-carrying members, particularly, building foundations in order to reduce the incessant incidence of collapsed building.
Abstract: Obesity, stunting and wasting problems among Thai school-aged children are increasing due to inappropriate food consumption behavior and poor environments for desirable nutritional behavior. Because of a low school lunch budget of only 0.40 USD per person per day, food quality is not up to nutritional standards. Therefore, the Health Department with the Education Ministry and the Thai Health Promotion Foundation have developed a quality school lunch project during 2009–2013. The program objectives were development and management of public policy to increase school lunch budget. The methods used a healthy public policy motivation process and movement in 241 local administrative organizations and 538 schools. The problem and solution research was organized to study school food and nutrition management, create a best practice policy mobilization model and hold a public hearing to motivate an increase of school meal funding. The results showed that local public policy has been motivated during 2009-2011 to increase school meal budget using local budgets. School children with best food consumption behavior and exercise increased from 13.2% in 2009 to 51.6% in 2013 and stunting decreased from 6.0% in 2009 to 4.7% in 2013. As the result of national policy motivation (2012-2013), the cabinet meeting on October 22, 2013 has approved an increase of school lunch budget from 0.40 USD to 0.62 USD per person per day. Thus, 5,800,469 school children nationwide have benefited from the budget increase.
Abstract: This study has only one objective which is to identify the different in factors of choosing the distributor for food and non-food OTOP entrepreneur in Thailand. In this research, the types of OTOP product will be divided into two groups which are food and non-food. The sample for the food type OTOP product was the processed fruit and vegetable from Nakorn Pathom province and the sample for the non-food type OTOP product was the court doll from Ang Thong province. The research was divided into 3 parts which were a study of the distribution pattern and how to choose the distributor of the food type OTOP product, a study of the distribution pattern and how to choose the distributor of the non-food type OTOP product and a comparison between 2 types of products to find the differentiation in the factor of choosing distributor. The data and information was collected by using the interview. The populations in the research were 5 producers of the processed fruit and vegetable from Nakorn Pathom province and 5 producers of the court doll from Ang Thong province. The significant factor in choosing the distributor of the food type OTOP product is the material handling efficiency and on-time delivery but for the non-food type OTOP product is focused on the channel of distribution and cost of the distributor.
Abstract: This research aims to study tourism data and behavior
of foreign tourists visited Wat Phrachetuponwimolmangkalaram (Wat
Po) Sample groups are tourists who visited inside the temple, during
February, March, April and May 2013. Tools used in the research are
questionnaires constructed by the researcher, and samples are dawn
by Convenience sampling. There are 207 foreign tourists who are
willing to be respondents. Statistics used are percentage, average
mean and standard deviation.
The results of the research reveal that:
A. General Data of Respondents
The foreign tourists who visited the temple are mostly female
(57.5 %), most respondents are aged between 20-29 years (37.2%).
Most respondents live in Europe (62.3%), most of them got the
Bachelor’s degree (40.1%), British are mostly found (16.4%),
respondents who are students are also found (23.2%), and Christian
are mostly found (60.9%).
B. Tourists’ Behavior While Visiting the Temple Compound.
The result shows that the respondents came with family (46.4%),
have never visited the temples (40.6%), and visited once (42 %). It is
found that the foreign tourists’ inappropriate behavior are wearing
revealing attires (58.9%), touching or getting closed to the monks
(55.1%), and speaking loudly (46.9%) respectively.
The respondents’ outstanding objectives are to visit inside the
temple (57.5%), to pay respect to the Reclining Buddha Image in the
Viharn (44.4%) and to worship the Buddha image in the Phra Ubosod
(37.7%) respectively.
C. The Respondents’ Self-evaluation of Performance
It is found that over all tourists evaluated themselves in the highest
level averaged 4.40. When focusing on each item, it is shown that
they evaluated themselves in the highest level on obeying the temple
staff averaged 4.57, and cleanness concern of the temple averaged
4.52, well-behaved performance during the temple visit averaged
4.47 respectively.
Abstract: This investigation develops a revisable method for estimating the estimate value of equivalent 10 Hz voltage flicker (DV10) of a DC Electric Arc Furnace (EAF). This study also discusses three 161kV DC EAFs by field measurement, with those results indicating that the estimated DV10 value is significantly smaller than the survey value. The key point is that the conventional means of estimating DV10 is inappropriate. There is a main cause as the assumed Qmax is too small.
Although DC EAF is regularly operated in a constant MVA mode, the reactive power variation in the Main Transformer (MT) is more significant than that in the Furnace Transformer (FT). A substantial difference exists between estimated maximum reactive power fluctuation (DQmax) and the survey value from actual DC EAF operations. However, this study proposes a revisable method that can obtain a more accurate DV10 estimate than the conventional method.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Lawsone is a pigment that occurs naturally in plants.
It has been used as a skin and hair dye for a long time. Moreover, its
different biological activities have been reported. The present study
focused on the effect of lawsone on a plant cell model represented by
tobacco BY-2 cell suspension culture, which is used as a model
comparable with the HeLa cells. It has been shown that lawsone
inhibits the cell growth in the concentration-dependent manner. In
addition, changes in DNA methylation level have been determined.
We observed decreasing level of DNA methylation in the presence of
increasing concentrations of lawsone. These results were
accompanied with overproduction of reactive oxygen species (ROS).
Since epigenetic modifications can be caused by different stress
factors, there could be a connection between the changes in the level
of DNA methylation and ROS production caused by lawsone.
Abstract: By running transactions under the SNAPSHOT isolation
we can achieve a good level of concurrency, specially in databases
with high-intensive read workloads. However, SNAPSHOT is not
immune to all the problems that arise from competing transactions
and therefore no serialization warranty exists. We propose in this
paper a technique to obtain data consistency with SNAPSHOT by using
some special triggers that we named DAEMON TRIGGERS. Besides
keeping the benefits of the SNAPSHOT isolation, the technique is
specially useful for those database systems that do not have an
isolation level that ensures serializability, like Firebird and Oracle. We
describe all the anomalies that might arise when using the SNAPSHOT
isolation and show how to preclude them with DAEMON TRIGGERS.
Based on the methodology presented here, it is also proposed the
creation of a new isolation level: DAEMON SNAPSHOT.
Abstract: Diverse contaminants released into the environment through progress of urbanization and industrialization adversely affect human health. Among various sources of contaminants, especially, in big cities, automobiles play a significant role in aggravating the pollution. Various pollutants viz., heavy metals (Pb, Mn, Ni, Zn, As, Hg, Cd) and Polyaromatic hydrocarbons (Benzo-a-pyrene, fluoranthene, pyrene, benzo-b-anthracene, benzo-b-fluoranthene, acenaphthylene, fluorine, phenantherene, anthracene, chrysene, benzo-k-fluoranthene, benzo-e-pyrene, indenol-1,2,3-cd-pyrene, dibenzo-a,h-anthracene, benzo-ghi-perylene) are released by vehicles. Further, these pollutants are expected to cause severe mutagenic, genotoxic and carcinogenic effects. Considering this, many authors monitored the levels of pollution in roadside soil, water and plants. The present review focuses upon the analysis and effects of heavy metals and polycyclic aromatic hydrocarbons from the roadside samples.
Abstract: Self-Consolidating Concrete (SCC) is considered as a relatively new technology created as an effective solution to problems associated with low quality consolidation. A SCC mix is defined as successful if it flows freely and cohesively without the intervention of mechanical compaction. The construction industry is showing high tendency to use SCC in many contemporary projects to benefit from the various advantages offered by this technology.
At this point, a main question is raised regarding the effect of enhanced fluidity of SCC on the structural behavior of high strength self-consolidating reinforced concrete.
A three phase research program was conducted at the American University of Beirut (AUB) to address this concern. The first two phases consisted of comparative studies conducted on concrete and mortar mixes prepared with second generation Sulphonated Naphtalene-based superplasticizer (SNF) or third generation Polycarboxylate Ethers-based superplasticizer (PCE). The third phase of the research program investigates and compares the structural performance of high strength reinforced concrete beam specimens prepared with two different generations of superplasticizers that formed the unique variable between the concrete mixes. The beams were designed to test and exhibit flexure, shear, or bond splitting failure.
The outcomes of the experimental work revealed comparable resistance of beam specimens cast using self-compacting concrete and conventional vibrated concrete. The dissimilarities in the experimental values between the SCC and the control VC beams were minimal, leading to a conclusion, that the high consistency of SCC has little effect on the flexural, shear and bond strengths of concrete members.
Abstract: This study adopts deterrence theory as well as social identities as moderators, and explores their moderating affects on online toxic disinhibition. Survey and Experimental methodologies are applied to test the research model and four hypotheses are developed in this study. The controllability of identity positively influenced the behavior of toxic disinhibition both in experimental and control groups while the fluidity of the identity did not have significant influences on online disinhibition. Punishment certainty, punishment severity as well as social identity negatively moderated the relation between the controllability of the identity and the toxic disinhibition. The result of this study shows that internet users hide their real identities when they behave inappropriately on internet, but once they acknowledge that the inappropriate behavior will be found and punished severely, the inappropriate behavior then will be weakened.
Abstract: Distillation consumes enormous quantity of energy. This work proposed a process to recover the energy from exit streams during the distillation process of three consecutive columns. There are several novel techniques to recover the heat with the distillation system; however, a complex control system is required. This work proposed a simpler technique by exchanging the heat between streams without interrupting the internal distillation process that might cause a serious control problem. The proposed process is executed by using heat exchanger network with pinch analysis to maximize the process heat recovery. The test model is the distillation of butane, pentane, hexane, and heptanes, which is a common mixture in the petroleum refinery. This proposed process saved the energy consumption for hot and cold utilities of 29 and 27%, which is considered significant. Therefore, the recovery of heat from exit streams from distillation process is proved to be effective for energy saving.
Abstract: We have built universal central pattern generator (CPG) hardware by interconnecting Hodgkin-Huxley neurons with reciprocally inhibitory synapses. We investigate the dynamics of neuron oscillations as a function of the time delay between current steps applied to individual neurons. We demonstrate stimulus dependent switching between spiking polyrhythms and map the phase portraits of the neuron oscillations to reveal the basins of attraction of the system. We experimentally study the dependence of the attraction basins on the network parameters: The neuron response time and the strength of inhibitory connections.
Abstract: Nowadays, flexibility introduced as a modern technology in furniture systems especially in interior planning design. According to results, the most important impact of these systems can be seen on open plan design that makes workspaces comfortable and increases the productivity of employees besides making good relationship between them. Briefly, there are some factors along with new systems in furniture design help create inappropriate space to make working better and easier while it has modular planning organization. It brings about some approaches to have a successful space for open offices with modular design and flexible furniture systems. These approaches have been investigated in open and close offices at Eastern Mediterranean University (EMU) in Famagusta, Cyprus, using information extracted from questionnaires.
Abstract: The objectives of this study were to isolate LAB from various sources, dietary supplement, Thai traditional fermented food, and freshwater fish and to characterize their potential as probiotic cultures. Out of 1,558 isolates, 730 were identified as LAB based on isolation on MRS agar supplemented with a bromocresol purple indicator&CaCO3 and Gram-positive, catalase- and oxidase-negative characteristics. Eight isolates showed the potential probiotic properties including tolerance to acid, bile salt & heat, proteolytic, amylolytic & lipolytic activities and oxalate-degrading capability. They all showed the antimicrobial activity against some Gram-negative and Gram-positive pathogenic bacteria. Based on 16S rDNA sequence analysis, they were identified as Enterococcus faecalis BT2 & MG30, Leconostoc mesenteroides SW64 and Pediococcus pentosaceous BD33, CF32, NP6, PS34 & SW5. The health beneficial effects and food safety will be further investigated and developed as a probiotic or protective culture used in Nile tilapia belly flap meat fermentation.
Abstract: Mixotrophic cultivation of the isolated freshwater microalgae Chlorella sp. KKU-S2 in batch shake flask for biomass and lipid productions, different concentration of glucose as carbon substrate, different nitrogen source and concentrations were investigated. Using 1.0g/L of NaNO3 as nitrogen source, the maximum biomass yield of 10.04g/L with biomass productivity of 1.673g/L d was obtained using 40g/L glucose, while a biomass of 7.09, 8.55 and 9.45g/L with biomass productivity of 1.182, 1.425 and 1.575g/L d were found at 20, 30 and 50g/L glucose, respectively. The maximum lipid yield of 3.99g/L with lipid productivity of 0.665g/L d was obtained when 40g/L glucose was used. Lipid yield of 1.50, 3.34 and 3.66g/L with lipid productivity of 0.250, 0.557 and 0.610g/L d were found when using the initial concentration of glucose at 20, 30 and 50g/L, respectively. Process product yield (YP/S) of 0.078, 0.119, 0.158 and 0.094 were observed when glucose concentration was 20, 30, 40 and 50 g/L, respectively. The results obtained from the study shows that mixotrophic culture of Chlorella sp. KKU-S2 is a desirable cultivation process for microbial lipid and biomass production.
Abstract: The availability of powerful eye-safe laser sources and the recent advancements in electro-optical and mechanical beam-steering components have allowed laser-based Light Detection and Ranging (LIDAR) to become a promising technology for obstacle warning and avoidance in a variety of manned and unmanned aircraft applications. LIDAR outstanding angular resolution and accuracy characteristics are coupled to its good detection performance in a wide range of incidence angles and weather conditions, providing an ideal obstacle avoidance solution, which is especially attractive in low-level flying platforms such as helicopters and small-to-medium size Unmanned Aircraft (UA). The Laser Obstacle Avoidance Marconi (LOAM) system is one of such systems, which was jointly developed and tested by SELEX-ES and the Italian Air Force Research and Flight Test Centre. The system was originally conceived for military rotorcraft platforms and, in this paper, we briefly review the previous work and discuss in more details some of the key development activities required for integration of LOAM on UA platforms. The main hardware and software design features of this LOAM variant are presented, including a brief description of the system interfaces and sensor characteristics, together with the system performance models and data processing algorithms for obstacle detection, classification and avoidance. In particular, the paper focuses on the algorithm proposed for optimal avoidance trajectory generation in UA applications.
Abstract: This study examined the effect of porous dielectric silica gel the discharge ignition voltage and input power in a plasma reactor. For the experiment was used a plasma reactor with two mesh electrodes made of stainless steel with a mesh size of 0.1x0.1mm. The study analyzed and compared with parameters such as power, ignition and operation voltage of the reactor for two dielectrics a porous and glass. During experiment were observed several new phenomena conducted for porous dielectric. The first phenomenon was the reduction the ignition voltage discharge to volume around few hundred volts. Second it was increase input power six times more compared with power those obtained for the glass dielectric. Thirdly difference it is ΔV between ignition voltage Vi and operating voltage reactor Vm for porous dielectric it was 11%, while ΔV for the glass dielectric it was 60%. Also change the discharge characteristics from DBD for glass dielectric to the streamer resistance discharge for the porous dielectric.
Abstract: Affordable housing delivery for low and lower middle income families is a prominent problem in many developing countries; governments alone are unable to address this challenge due to diverse financial and regulatory constraints, and the private sector's contribution is rare and assists only middle-income households even when institutional and legal reforms are conducted to persuade it to go down market. Also, the market-enabling policy measures advocated by the World Bank since the early nineties have been strongly criticized and proven to be inappropriate to developing country contexts, where it is highly unlikely that the formal private sector can reach low income population. In addition to governments and private developers, affordable housing delivery systems involve an intricate network of relationships between a diverse range of actors. Collaboration between them was proven to be vital, and hence, an approach towards partnership schemes for affordable housing delivery has emerged. The basic premise of this paper is that addressing housing affordability challenges in Egypt demands direct public support, as markets and market actors alone would never succeed in delivering decent affordable housing to low and lower middle income groups. It argues that this support would ideally be through local level partnership schemes, with a leading decentralized local government role, and partners being identified according to specific local conditions. It attempts to identify major attributes that would ensure the fulfillment of the goals of such schemes in the Egyptian context. This is based upon evidence from diversified worldwide experiences, in addition to the main outcomes of a questionnaire that was conducted to specialists and chief actors in the field.