Abstract: s the floating offshore wind turbine industry continues to develop and grow, the capabilities of established port facilities need to be assessed as to their ability to support the expanding construction and installation requirements. This paper assesses current infrastructure requirements and projected changes to port facilities that may be required to support the floating offshore wind industry. Understanding the infrastructure needs of the floating offshore renewable industry will help to identify the port-related requirements. Floating offshore wind turbines can be installed further out to sea and in deeper waters than traditional fixed offshore wind arrays, meaning it can take advantage of stronger winds. Separate ports are required for substructure construction, fit-out of the turbines, moorings, subsea cables and maintenance. Large areas are required for the laydown of mooring equipment, inter array cables, turbine blades and nacelles. The capabilities of established port facilities to support floating wind farms are assessed by evaluation of size of substructures, height of wind turbine with regards to the cranes for fitting of blades, distance to offshore site and offshore installation vessel characteristics. The paper will discuss the advantages and disadvantages of using large land based cranes, inshore floating crane vessels or offshore crane vessels at the fit-out port for the installation of the turbine. Water depths requirements for import of materials and export of the completed structures will be considered. There are additional costs associated with any emerging technology. However, part of the popularity of Floating Offshore Wind Turbines stems from the cost savings against permanent structures like fixed wind turbines. Floating Offshore Wind Turbine developers can benefit from lighter, more cost effective equipment which can be assembled in port and towed to site rather than relying on large, expensive installation vessels to transport and erect fixed bottom turbines. The ability to assemble Floating Offshore Wind Turbines equipment on shore means minimising highly weather dependent operations like offshore heavy lifts and assembly, saving time and costs and reducing safety risks for offshore workers. Maintenance might take place in safer onshore conditions for barges and semi submersibles. Offshore renewables, such as floating wind, can take advantage of this wealth of experience, while oil and gas operators can deploy this experience at the same time as entering the renewables space. The floating offshore wind industry is in the early stages of development and port facilities are required for substructure fabrication, turbine manufacture, turbine construction and maintenance support. The paper discusses the potential floating wind substructures as this provides a snapshot of the requirements at the present time, and potential technological developments required for commercial development. Scaling effects of demonstration-scale projects will be addressed; however the primary focus will be on commercial-scale (30+ units) device floating wind energy farms.
Abstract: Frequency diverse array (FDA) beamforming is a technology developed in recent years, and its antenna pattern has a unique angle-distance-dependent characteristic. However, the beam is always required to have strong concentration, high resolution and low sidelobe level to form the point-to-point interference in the concentrated set. In order to eliminate the angle-distance coupling of the traditional FDA and to make the beam energy more concentrated, this paper adopts a multi-carrier FDA structure based on proposed power exponential frequency offset to improve the array structure and frequency offset of the traditional FDA. The simulation results show that the beam pattern of the array can form a dot-shape beam with more concentrated energy, and its resolution and sidelobe level performance are improved. However, the covariance matrix of the signal in the traditional adaptive beamforming algorithm is estimated by the finite-time snapshot data. When the number of snapshots is limited, the algorithm has an underestimation problem, which leads to the estimation error of the covariance matrix to cause beam distortion, so that the output pattern cannot form a dot-shape beam. And it also has main lobe deviation and high sidelobe level problems in the case of limited snapshot. Aiming at these problems, an adaptive beamforming technique based on exponential correction for multi-carrier FDA is proposed to improve beamforming robustness. The steps are as follows: first, the beamforming of the multi-carrier FDA is formed under linear constrained minimum variance (LCMV) criteria. Then the eigenvalue decomposition of the covariance matrix is performed to obtain the diagonal matrix composed of the interference subspace, the noise subspace and the corresponding eigenvalues. Finally, the correction index is introduced to exponentially correct the small eigenvalues of the noise subspace, improve the divergence of small eigenvalues in the noise subspace, and improve the performance of beamforming. The theoretical analysis and simulation results show that the proposed algorithm can make the multi-carrier FDA form a dot-shape beam at limited snapshots, reduce the sidelobe level, improve the robustness of beamforming, and have better performance.
Abstract: The purpose of the study is to analyze the load rejection transient of ABWR by using TRACE, PARCS, and SNAP codes. This study has some steps. First, using TRACE, PARCS, and SNAP codes establish the model of ABWR. Second, the key parameters are identified to refine the TRACE/PARCS/SNAP model further in the frame of a steady state analysis. Third, the TRACE/PARCS/SNAP model is used to perform the load rejection transient analysis. Finally, the FSAR data are used to compare with the analysis results. The results of TRACE/PARCS are consistent with the FSAR data for the important parameters. It indicates that the TRACE/PARCS/SNAP model of ABWR has a good accuracy in the load rejection transient.
Abstract: To confirm the reactor and containment integrity of the Advanced Boiling Water Reactor (ABWR), we perform the analysis of main steamline break (MSLB) transient by using the TRACE, PARCS, and SNAP codes. The process of the research has four steps. First, the ABWR nuclear power plant (NPP) model is developed by using the above codes. Second, the steady state analysis is performed by using this model. Third, the ABWR model is used to run the analysis of MSLB transient. Fourth, the predictions of TRACE and PARCS are compared with the data of FSAR. The results of TRACE/PARCS and FSAR are similar. According to the TRACE/PARCS results, the reactor and containment integrity of ABWR can be maintained in a safe condition for MSLB.
Abstract: In this research, TRACE code with the interface code-SNAP was used to simulate and analyze the SBO (station blackout) accident which occurred in Maanshan PWR (pressurized water reactor) nuclear power plant (NPP). There are four main steps in this research. First, the SBO accident data of Maanshan NPP were collected. Second, the TRACE/SNAP model of Maanshan NPP was established by using these data. Third, this TRACE/SNAP model was used to perform the simulation and analysis of SBO accident. Finally, the simulation and analysis of SBO with mitigation equipments was performed. The analysis results of TRACE are consistent with the data of Maanshan NPP. The mitigation equipments of Maanshan can maintain the safety of Maanshan in the SBO according to the TRACE predictions.
Abstract: This research aims to investigate the role of social media (Snapchat, Facebook, Twitter, etc.) in our daily lives and its implication on our everyday routine in the form of stressors. The study has been validated by a social media survey with 150 social media users belonging to various age groups. The study explores how social media can make an individual anti-social in his or her life offline. To explain the phenomenon, we have proposed and evaluated a model based on social media usage and stressors including burnout and social overload. Results, through correlation and regression tests, have revealed that with increase in social media usage, social overload and burnout also increases. Evidence for the fact that excessive social media usage causes social overload and burnout has been provided in the study.
Abstract: In this study, we focus on the establishment of the analysis model for Maanshan PWR nuclear power plant (NPP) by using RADTRAD and SNAP codes with the FSAR, manuals, and other data. In order to evaluate the cumulative dose at the Exclusion Area Boundary (EAB) and Low Population Zone (LPZ) outer boundary, Maanshan NPP RADTRAD/SNAP model was used to perform the analysis of the DBA LOCA case. The analysis results of RADTRAD were similar to FSAR data. These analysis results were lower than the failure criteria of 10 CFR 100.11 (a total radiation dose to the whole body, 250 mSv; a total radiation dose to the thyroid from iodine exposure, 3000 mSv).
Abstract: Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of Spent Fuel Pools (SFPs) in Taiwan after Fukushima event. In order to estimate the safety of Kuosheng NPP SFP, by using MELCOR2.1 and SNAP, the safety analysis of Kuosheng NPP SFP was performed combined with the mitigation strategy of NEI 06-12 report. There were several steps in this research. First, the Kuosheng NPP SFP models were established by MELCOR2.1/SNAP. Second, the Station Blackout (SBO) analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition. The results showed that the calculations of MELCOR and TRACE were very similar in this case. Second, the mitigation strategy analysis was done with the MELCOR model by following the NEI 06-12 report. The results showed the effectiveness of NEI 06-12 strategy in Kuosheng NPP SFP. Finally, a sensitivity study of SFP quenching was done to check the differences of different water injection time and the phenomena during the quenching. The results showed that if the cladding temperature was over 1600 K, the water injection may have chance to cause the accident more severe with more hydrogen generation. It was because of the oxidation heat and the “Breakaway” effect of the zirconium-water reaction. An animation model built by SNAP was also shown in this study.
Abstract: In this study of ultimate response guideline (URG), Kuosheng BWR/6 nuclear power plant (NPP) TRACE model was established. The reactor depressurization, low pressure water injection, and containment venting are the main actions of URG. This research focuses to evaluate the efficiency of URG under Fukushima-like conditions. Additionally, the sensitivity study of URG was also performed in this research. The analysis results of TRACE present that URG can keep the peak cladding temperature (PCT) below 1088.7 K (the failure criteria) under Fukushima-like conditions. It implied that Kuosheng NPP was at the safe situation.
Abstract: After the measurement uncertainty recapture (MUR) power uprates, Kuosheng nuclear power plant (NPP) was uprated the power from 2894 MWt to 2943 MWt. For power upgrade, several codes (e.g., TRACE, RELAP5, etc.) were applied to assess the safety of Kuosheng NPP. Hence, the main work of this research is to establish a RELAP5/MOD3.3 model of Kuosheng NPP with SNAP interface. The establishment of RELAP5/SNAP model was referred to the FSAR, training documents, and TRACE model which has been developed and verified before. After completing the model establishment, the startup test scenarios would be applied to the RELAP5/SNAP model. With comparing the startup test data and TRACE analysis results, the applicability of RELAP5/SNAP model would be assessed.
Abstract: Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of NPPs in Taiwan after Japan Fukushima NPP disaster occurred. Hence, in order to estimate the safety of Kuosheng NPP spent fuel pool (SFP), by using TRACE, MELCOR, and SNAP codes, the safety analysis of Kuosheng NPP SFP was performed. There were two main steps in this research. First, the Kuosheng NPP SFP models were established. Second, the transient analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition (Fukushima-like condition). The results showed that the calculations of MELCOR and TRACE were very similar in this case, and the fuel uncover happened roughly at 4th day after the failure of cooling system. The above results indicated that Kuosheng NPP SFP may be unsafe in the case of long-term SBO situation. In addition, future calculations were needed to be done by the other codes like FRAPTRAN for the cladding calculations.
Abstract: TRACE is developed by U.S. NRC for the nuclear
power plants (NPPs) safety analysis. We focus on the establishment
and application of TRACE/FRAPTRAN/SNAP models for Chinshan
NPP (BWR/4) spent fuel pool in this research. The geometry is 12.17
m × 7.87 m × 11.61 m for the spent fuel pool. In this study, there are
three TRACE/SNAP models: one-channel, two-channel, and
multi-channel TRACE/SNAP model. Additionally, the cooling system
failure of the spent fuel pool was simulated and analyzed by using the
above models. According to the analysis results, the peak cladding
temperature response was more accurate in the multi-channel
TRACE/SNAP model. The results depicted that the uncovered of the
fuels occurred at 2.7 day after the cooling system failed. In order to
estimate the detailed fuel rods performance, FRAPTRAN code was
used in this research. According to the results of FRAPTRAN, the
highest cladding temperature located on the node 21 of the fuel rod
(the highest node at node 23) and the cladding burst roughly after 3.7
day.
Abstract: The first layer of defense against data loss is the backup
data. This paper implements an agent-based network backup system
used the backup, server-storage and server-backup agent these
tripartite construction, and the snapshot and hierarchical index are
used in the NSBS. It realizes the control command and data flow
separation, balances the system load, thereby improving efficiency of
the system backup and recovery. The test results show the agent-based
network backup system can effectively improve the task-based
concurrency, reasonably allocate network bandwidth, the system
backup performance loss costs smaller and improves data recovery
efficiency by 20%.
Abstract: Multiple-input multiple-output (MIMO) radar has
received increasing attention in recent years. MIMO radar has many
advantages over conventional phased array radar such as target
detection,resolution enhancement, and interference suppression. In
this paper, the results are presented from a simulation study of MIMO
uniformly-spaced linear array (ULA) antennas. The performance is
investigated under varied parameters, including varied array size,
pseudo random (PN) sequence length, number of snapshots, and
signal to noise ratio (SNR). The results of MIMO are compared to a
traditional array antenna.
Abstract: Breast cancer is considered as a substantial health
concern and practicing mammography screening [MS] is important in
minimizing its related morbidity. So it is essential to have a better
understanding of breast cancer screening behaviors of women and
factors that influence utilization of them. The aim of this study is to
identify the factors that are linked to MS behaviors among the
Egyptian women. A cross-sectional descriptive design was carried
out to provide a snapshot of the factors that are linked to MS
behaviors. A convenience sample of 311 women was utilized and all
eligible participants admitted to the Women Imaging Unit who are 40
years of age or above, coming for mammography assessment, not
pregnant or breast feeding and who accepted to participate in the
study were included. A structured questionnaire was developed by
the researchers and contains three parts; Socio-demographic data;
Motivating factors associated with MS; and association between MS
and model of behavior change. The analyzed data indicated that most
of the participated women (66.6%) belonged to the age group of 40-
49.A high proportion of participants (58.1%) of group having
previous MS influenced by their neighbors to practice MS, whereas
32.7 % in group not having previous MS were influenced by family
members which indicated significant differences (P
Abstract: This paper describes the tradeoffs and the design from
scratch of a self-contained, easy-to-use health dashboard software
system that provides customizable data tracking for patients in smart
homes. The system is made up of different software modules and
comprises a front-end and a back-end component. Built with HTML,
CSS, and JavaScript, the front-end allows adding users, logging into
the system, selecting metrics, and specifying health goals. The backend
consists of a NoSQL Mongo database, a Python script, and a
SimpleHTTPServer written in Python. The database stores user
profiles and health data in JSON format. The Python script makes use
of the PyMongo driver library to query the database and displays
formatted data as a daily snapshot of user health metrics against
target goals. Any number of standard and custom metrics can be
added to the system, and corresponding health data can be fed
automatically, via sensor APIs or manually, as text or picture data
files. A real-time METAR request API permits correlating weather
data with patient health, and an advanced query system is
implemented to allow trend analysis of selected health metrics over
custom time intervals. Available on the GitHub repository system,
the project is free to use for academic purposes of learning and
experimenting, or practical purposes by building on it.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: By running transactions under the SNAPSHOT isolation
we can achieve a good level of concurrency, specially in databases
with high-intensive read workloads. However, SNAPSHOT is not
immune to all the problems that arise from competing transactions
and therefore no serialization warranty exists. We propose in this
paper a technique to obtain data consistency with SNAPSHOT by using
some special triggers that we named DAEMON TRIGGERS. Besides
keeping the benefits of the SNAPSHOT isolation, the technique is
specially useful for those database systems that do not have an
isolation level that ensures serializability, like Firebird and Oracle. We
describe all the anomalies that might arise when using the SNAPSHOT
isolation and show how to preclude them with DAEMON TRIGGERS.
Based on the methodology presented here, it is also proposed the
creation of a new isolation level: DAEMON SNAPSHOT.
Abstract: This analysis of Kuosheng nuclear power plant (NPP)
was performed mainly by TRACE, assisted with FRAPTRAN and
FRAPCON. SNAP v2.2.1 and TRACE v5.0p3 are used to develop the
Kuosheng NPP SPU TRACE model which can simulate the turbine
trip without bypass transient. From the analysis of TRACE, the
important parameters such as dome pressure, coolant temperature and
pressure can be determined. Through these parameters, comparing
with the criteria which were formulated by United States Nuclear
Regulatory Commission (U.S. NRC), we can determine whether the
Kuoshengnuclear power plant failed or not in the accident analysis.
However, from the data of TRACE, the fuel rods status cannot be
determined. With the information from TRACE and burn-up analysis
obtained from FRAPCON, FRAPTRAN analyzes more details about
the fuel rods in this transient. Besides, through the SNAP interface, the
data results can be presented as an animation. From the animation, the
TRACE and FRAPTRAN data can be merged together that may be
realized by the readers more easily. In this research, TRACE showed
that the maximum dome pressure of the reactor reaches to 8.32 MPa,
which is lower than the acceptance limit 9.58 MPa. Furthermore,
FRAPTRAN revels that the maximum strain is about 0.00165, which
is below the criteria 0.01. In addition, cladding enthalpy is 52.44 cal/g
which is lower than 170 cal/g specified by the USNRC NUREG-0800
Standard Review Plan.
Abstract: With a surge of stream processing applications novel
techniques are required for generation and analysis of association
rules in streams. The traditional rule mining solutions cannot handle
streams because they generally require multiple passes over the data
and do not guarantee the results in a predictable, small time. Though
researchers have been proposing algorithms for generation of rules
from streams, there has not been much focus on their analysis.
We propose Association rule profiling, a user centric process for
analyzing association rules and attaching suitable profiles to them
depending on their changing frequency behavior over a previous
snapshot of time in a data stream.
Association rule profiles provide insights into the changing nature
of associations and can be used to characterize the associations. We
discuss importance of characteristics such as predictability of
linkages present in the data and propose metric to quantify it. We
also show how association rule profiles can aid in generation of user
specific, more understandable and actionable rules.
The framework is implemented as SUPAR: System for Usercentric
Profiling of Association Rules in streaming data. The
proposed system offers following capabilities:
i) Continuous monitoring of frequency of streaming item-sets
and detection of significant changes therein for association rule
profiling.
ii) Computation of metrics for quantifying predictability of
associations present in the data.
iii) User-centric control of the characterization process: user
can control the framework through a) constraint specification and b)
non-interesting rule elimination.