Abstract: In this paper, a backward semi-Lagrangian scheme
combined with the second-order backward difference formula
is designed to calculate the numerical solutions of nonlinear
advection-diffusion equations. The primary aims of this paper are
to remove any iteration process and to get an efficient algorithm
with the convergence order of accuracy 2 in time. In order to achieve
these objects, we use the second-order central finite difference and the
B-spline approximations of degree 2 and 3 in order to approximate
the diffusion term and the spatial discretization, respectively. For the
temporal discretization, the second order backward difference formula
is applied. To calculate the numerical solution of the starting point
of the characteristic curves, we use the error correction methodology
developed by the authors recently. The proposed algorithm turns out
to be completely iteration free, which resolves the main weakness
of the conventional backward semi-Lagrangian method. Also, the
adaptability of the proposed method is indicated by numerical
simulations for Burgers’ equations. Throughout these numerical
simulations, it is shown that the numerical results is in good
agreement with the analytic solution and the present scheme offer
better accuracy in comparison with other existing numerical schemes.
Abstract: This paper presents a neural network based model predictive control (MPC) strategy to control a strongly exothermic reaction with complicated nonlinear kinetics given by Chylla-Haase polymerization reactor that requires a very precise temperature control to maintain product uniformity. In the benchmark scenario, the operation of the reactor must be guaranteed under various disturbing influences, e.g., changing ambient temperatures or impurity of the monomer. Such a process usually controlled by conventional cascade control, it provides a robust operation, but often lacks accuracy concerning the required strict temperature tolerances. The predictive control strategy based on the RBF neural model is applied to solve this problem to achieve set-point tracking of the reactor temperature against disturbances. The result shows that the RBF based model predictive control gives reliable result in the presence of some disturbances and keeps the reactor temperature within a tight tolerance range around the desired reaction temperature.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: The work presented in this paper was performed for a workstation of an assembly section in a company that manufactures radio modules and air conditioning for cars. After performing a workstation analysis and a questionnaire to the operators it was possible to understand the need to investigate the risk of musculoskeletal disorders originated from both the handling of loads as the incorrect dimensioning of the workstation. Regarding the handling of loads the NIOSH Equation was used and it was verified that there was no risk of musculoskeletal disorders. As the operators expressed their lack of satisfaction regarding back pains due to posture adopted they were established the appropriate dimensions (to satisfy 97.5% of the population and using the table of anthropometric data of the Portuguese population) for the workstation and it was proposed the availability of a chair for the workers.
Abstract: In this study, Electrical Discharge Machining (EDM) is used to modify the surface of high carbon steel En31 with the help of tool electrode (Copper-Chromium-Nickel) manufactured by powder metallurgy (PM) process. The effect of EDM on surface roughness during surface alloying is studied. Taguchi’s Design of experiment (DOE) and L18 orthogonal array is used to find the best level of input parameters in order to achieve high surface finish. Six input parameters are considered and their percentage contribution towards surface roughness is investigated by analysis of variances (ANOVA). Experimental results show that an hard alloyed surface (1.21% carbon, 2.14% chromium and 1.38% nickel) with surface roughness of 3.19µm can be generated using EDM with PM tool. Additionally, techniques like Scanning Electron Microscope (SEM) and Energy Dispersive Spectroscopy (EDS) are used to analyze the machined surface and EDMed layer composition, respectively. The increase in machined surface micro-hardness (101%) may be related to the formation of carbides containing chromium.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: This paper presents the findings from a numerical simulation of the flow in 37-rod fuel assembly models spaced by a double-wire trapezoidal wrapping as applied to the BREST-OD-300 experimental nuclear reactor. Data on a high static pressure distribution within the models, and equations for determining the fuel bundle flow friction factors have been obtained. Recommendations are provided on using the closing turbulence models available in the ANSYS Fluent. A comparative analysis has been performed against the existing empirical equations for determining the flow friction factors. The calculated and experimental data fit has been shown.
An analysis into the experimental data and results of the numerical simulation of the BREST-OD-300 fuel rod assembly hydrodynamic performance are presented.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: The semiconductor industry is placing an increased
emphasis on emerging materials and devices that may provide
improved performance, or provide novel functionality for devices.
Recently, graphene, as a true two-dimensional carbon material, has
shown fascinating applications in electronics. In this paper detailed
discussions are introduced for possible applications of grapheme
Transistor in RF and digital devices.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.
Abstract: The purposes of this research were (1) to create a
learning activity for constructivism, (2) study the Mathematical
Analysis courses learning achievement, and (3) study students’
attitude toward the learning activity for constructivism. The samples
in this study were divided into 2 parts including 3 Mathematical
Analysis courses instructors of Suan Sunandha Rajabhat University
who provided basic information and attended the seminar and 17
Mathematical Analysis courses students who were studying in the
academic and engaging in the learning activity for constructivism.
The research instruments were lesson plans constructivism,
subjective Mathematical Analysis courses achievement test with
reliability index of 0.8119, and an attitude test concerning the
students’ attitude toward the Mathematical Analysis courses learning
activity for constructivism. The result of the research show that the
efficiency of the Mathematical Analysis courses learning activity for
constructivism is 73.05/72.16, which is more than expected criteria of
70/70. The research additionally find that the average score of
learning achievement of students who engaged in the learning
activities for constructivism are equal to 70% and the students’
attitude toward the learning activity for constructivism are at the
medium level.