Abstract: This research aims to study tourism data and behavior
of foreign tourists visited Wat Phrachetuponwimolmangkalaram (Wat
Po) Sample groups are tourists who visited inside the temple, during
February, March, April and May 2013. Tools used in the research are
questionnaires constructed by the researcher, and samples are dawn
by Convenience sampling. There are 207 foreign tourists who are
willing to be respondents. Statistics used are percentage, average
mean and standard deviation.
The results of the research reveal that:
A. General Data of Respondents
The foreign tourists who visited the temple are mostly female
(57.5 %), most respondents are aged between 20-29 years (37.2%).
Most respondents live in Europe (62.3%), most of them got the
Bachelor’s degree (40.1%), British are mostly found (16.4%),
respondents who are students are also found (23.2%), and Christian
are mostly found (60.9%).
B. Tourists’ Behavior While Visiting the Temple Compound.
The result shows that the respondents came with family (46.4%),
have never visited the temples (40.6%), and visited once (42 %). It is
found that the foreign tourists’ inappropriate behavior are wearing
revealing attires (58.9%), touching or getting closed to the monks
(55.1%), and speaking loudly (46.9%) respectively.
The respondents’ outstanding objectives are to visit inside the
temple (57.5%), to pay respect to the Reclining Buddha Image in the
Viharn (44.4%) and to worship the Buddha image in the Phra Ubosod
(37.7%) respectively.
C. The Respondents’ Self-evaluation of Performance
It is found that over all tourists evaluated themselves in the highest
level averaged 4.40. When focusing on each item, it is shown that
they evaluated themselves in the highest level on obeying the temple
staff averaged 4.57, and cleanness concern of the temple averaged
4.52, well-behaved performance during the temple visit averaged
4.47 respectively.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: The sound pressure level (SPL) of the moving-coil
loudspeaker (MCL) is often simulated and analyzed using the lumped
parameter model. However, the SPL of a MCL cannot be simulated
precisely in the high frequency region, because the value of cone
effective area is changed due to the geometry variation in different
mode shapes, it is also related to affect the acoustic radiation mass and
resistance. Herein, the paper presents the inverse method which has a
high ability to measure the value of cone effective area in various
frequency points, also can estimate the MCL electroacoustic
parameters simultaneously. The proposed inverse method comprises
the direct problem, adjoint problem, and sensitivity problem in
collaboration with nonlinear conjugate gradient method. Estimated
values from the inverse method are validated experimentally which
compared with the measured SPL curve result. Results presented in
this paper not only improve the accuracy of lumped parameter model
but also provide the valuable information on loudspeaker cone design.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: The objectives of this study is to investigate the impact
of culture on advertising appeals in mobile phone industry via social
media channel in UK, Brazil and India. Content analysis on Samsung
and Nokia commercials in YouTube is conducted. The result
indicates that the advertising appeals are both congruent and
incongruent with cultural dimensions in UK, Brazil and India. The
result suggests that Hofstede and value paradoxes might be the tools
to predict the relationship between cultural values and advertising
appeals.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Present research investigates eclecticism in Iranian
theatre on the basis of eclectic theory. Eclectic theatre is a new theory
in postmodernism. The theory appeared during 60th – 70th century in
some theatres such as “Conference of the Birds”.
Special theatrical forms have been developed in many
geographical- cultural areas of the world and are indigenous to that
area. These forms, as compared with original forms, are considered to
be traditional while being comprehensive, the form is considered to
be national. Kaboudan and Sfandiar theatre has been influenced by
elements of traditional form of Iran.
Abstract: This study analyzes the crisis management and image repair strategies during the crisis of Mahidol Wittayanusorn School (MWIT) library burning. The library of this school was burned by a 16-year-old-male student on June 6th, 2010. This student blamed the school that the lesson was difficult, and other students were selfish. Although no one was in the building during the fire, it had caused damage to the building, books and electronic supplies around 130 million bahts (4.4 million USD). This event aroused many discourses arguing about the education system and morality. The strategies which were used during crisis were denial, shift the blame, bolstering, minimization, and uncertainty reduction. The results of using these strategies appeared after the crisis. That was the numbers of new students, who registered for the examination to get into this school in the later years, have remained the same.
Abstract: This study examines whether the Taiwan’s public debt is sustainable utilizing an unrestricted two-regime threshold autoregressive (TAR) model with an autoregressive unit root. The empirical results show that Taiwan’s public debt appears as a nonlinear series and is stationary in regime 1 but not in regime 2. This result implies that while Taiwan’s public debt was mostly sustainable over the 1996 to 2013 period examined in the study, it may no longer be sustainable in the most recent two years as the public debt ratio has increased cumulatively to 3.618%.
Abstract: The purpose of this study is to investigate hedonic online shopping motivations. A qualitative analysis was conducted to explore the factors influencing online hedonic shopping motivations. The results of the study indicate that traditional hedonic values, consisting of social, role, self-gratification, learning trends, pleasure of bargaining, stimulation, diversion, status, and adventure, and dimensions of flow theory, consisting of control, curiosity, enjoyment, and telepresence, exist in the online shopping environment. Two hedonic motivations unique to Internet shopping, privacy and online shopping achievement, were found. It appears that the most important hedonic value to online shoppers is having the choice to interact or not interact with others while shopping on the Internet. This study serves as a basis for the future growth of Internet marketing.
Abstract: In recent years, the adoption of mobile phones has been exceptionally rapid in many parts of the world, and Tanzania is not exceptional. We are witnessing a number of new mobile network operators being licensed from time to time by Tanzania Communications Regulatory Authority (TCRA). This makes competition in the telecommunications market very stiff. All mobile phone companies are struggling to earn more new customers into their networks. This trend courses a stiff competition. The various measures are being taken by different companies including, lowering tariff, and introducing free short messages within and out of their networks, and free calls during off-peak periods. This paper is aimed at investigating the influence of tariffs on students’ mobile customers in selecting their mobile network operators. About seventy seven students from high learning institutions in Dodoma Municipality, Tanzania, participated in responding to the prepared questionnaires. The sought information was aimed at determining if tariffs influenced students into selection of their current mobile operators. The results indicate that tariffs were the major driving factor in selection of mobile operators. However, female mobile customers were found to be more easily attracted into subscribing to a mobile operator due to low tariffs, a bigger number of free short messages or discounted call charges than their fellow male customers.
Abstract: This research paper was aimed to examine the relationship between visitors’ attitude towards the service marketing mix and visitors’ frequency of visit to Bangpu Recreation Centre. Based on a large and uncalculated population, the number of samples was calculated according to the formula to obtain a total of 385 samples. In collecting the samples, systematic random sampling was applied and by using of a Likert five-scale questionnaire for, a total of 21 days to collect the needed information. Mean, Standard Deviation, and Pearson’s basic statistical correlations were utilized in analyzing the data. This study discovered a high level of visitors’ attitude product and service of Bangpu Recreation Centre, price, place, promotional activities, people who provided service and physical evidence of the centre. The attitude towards process of service was discovered to be at a medium level. Additionally, the finding of an examination of a relationship between visitors’ attitude towards service marketing mix and visitors’ frequency of visit to Bangpu Recreation Centre presented that product and service, people, physical evidence and process of service provision showed a relationship with the visitors’ frequency of visit to the centre per year.
Abstract: The objectives of this project are to study on the work
efficiency of the employees, sorted by their profiles, and to study on
the relation between job attributes and work efficiency of employees
of Suan Sunandha Rajabhat University. The samples used for this
study are 292 employees. The statistics used in this study are
frequencies, standard deviations, One-way ANOVA and Pearson’s
correlation coefficient. Majority of respondent were male with an
undergraduate degree, married and lives together. The average age of
respondents was between 31-41 years old, married and the
educational background are higher than bachelor’s degree. The job
attribute is correlated to the work efficiency with the statistical
significance level of.o1. This concurs with the predetermined
hypothesis. The correlation between the two main factors is in the
moderate level. All the categories of job attributes such as the variety
of skills, job clarity, job importance, freedom to do work are
considered separately.
Abstract: Single-phase, high band gap energy Zn0.5Mg0.5O films were grown under oxygen pressure, using pulse laser deposition with a Zn0.5Mg0.5O target. Structural characterization studies revealed that the crystal structures of the ZnX-1MgXO films could be controlled via changes in the oxygen pressure. TEM analysis showed that the thickness of the deposited Zn1-xMgxO thin films was 50–75 nm. As the oxygen pressure increased, we found that one axis of the crystals did not show a very significant increase in the crystallization compared with that observed at low oxygen pressure. The X-ray diffraction peak intensity for the hexagonal-ZnMgO (002) plane increased relative to that for the cubic-ZnMgO (111) plane. The corresponding c-axis of the h-ZnMgO lattice constant increased from 5.141 to 5.148 Å, and the a-axis of the c-ZnMgO lattice constant decreased from 4.255 to 4.250 Å. EDX analysis showed that the Mg content in the mixed-phase ZnMgO films decreased significantly, from 54.25 to 46.96 at.%. As the oxygen pressure was increased from 100 to 150 mTorr, the absorption edge red-shifted from 3.96 to 3.81 eV; however, a film grown at the highest oxygen pressure tested here (200 mTorr).
Abstract: The study aimed to collect morphological data of
secretory structures that contribute to taxonomy of Indigofera. Detail
features of trichomes occurrence in vegetative and reproductive
organs of Indigofera wightii Grah. ex Wigh & Arn., a species
traditionally used as source of indigo to dye “Thaisongdam” clothing
were investigated. Examination through light microscopy and
scanning electrom microscopy were done. Non secretory, T-shaped
trichomes appeared throughout surfaces of stems, leaves, flowers and
fruits. Secretory or glandular trichomes occurred in two types; one
has big cylindrical head and short peduncle, distributed on adaxial
surface of sepals and around the pedicel, whereas another possesses
smaller cylindrical head but long peduncle. The latter was found on
apical surface of immature pods. No phenolic and lipophilic
compounds were detected from these glands.
Abstract: Use of plants grown in local area for edible has a long tradition in different culture. The indigenous knowledge such as usage of plants as vegetables by local people is risk to disappear when no records are done. In order to conserve and transfer this valuable heritage to the new generation, ethnobotanical study should be investigated and documented. The survey of vegetable plants traditionally used was carried out in the year 2012. Information was accumulated via questionnaires and oral interviewing from 100 people living in 36 villages of 9 districts in Amphoe Huai Mek, Kalasin, Thailand. Local plant names, utilized parts and preparation methods of the plants were recorded. Each mentioned plant species were collected and voucher specimens were prepared. A total of 55 vegetable plant species belonging to 34 families and 54 genera were identified. The plant habits were tree, shrub, herb, climber, and shrubby fern at 21.82%, 18.18%, 38.18%, 20.00% and 1.82% respectively. The most encountered vegetable plant families were Leguminosae (20%), Cucurbitaceae (7.27%), Apiaceae (5.45%), whereas families with 3.64% uses were Araceae, Bignoniaceae, Lamiaceae, Passifloraceae, Piperaceae and Solanaceae. The most common consumptions were fresh or brief boiled young shoot or young leaf as side dishes of ‘jaeo, laab, namprik, pon’ or curries. Most locally known vegetables included 45% of the studied plants which grow along road side, backyard garden, hedgerow, open forest and rice field.
Abstract: This work investigates the wear of a steam turbine blade coated with titanium nitride (TiN), and compares to the wear of uncoated blades. The coating is deposited on by physical vapor deposition (PVD) method. The working conditions of the blade were simulated and surface temperature and pressure values as well as flow velocity and flow direction were obtained. This data was used in the finite element wear model developed here in order to predict the wear of the blade. The wear mechanisms considered are erosive wear due to particle impingement and fluid jet, and fatigue wear due to repeated impingement of particles and fluid jet. Results show that the life of the TiN-coated blade is approximately 1.76 times longer than the life of the uncoated one.