Abstract: Estimation of a proportion has many applications in
economics and social studies. A common application is the estimation
of the low income proportion, which gives the proportion of people
classified as poor into a population. In this paper, we present this
poverty indicator and propose to use the logistic regression estimator
for the problem of estimating the low income proportion. Various
sampling designs are presented. Assuming a real data set obtained
from the European Survey on Income and Living Conditions, Monte
Carlo simulation studies are carried out to analyze the empirical
performance of the logistic regression estimator under the various
sampling designs considered in this paper. Results derived from
Monte Carlo simulation studies indicate that the logistic regression
estimator can be more accurate than the customary estimator under
the various sampling designs considered in this paper. The stratified
sampling design can also provide more accurate results.
Abstract: In the 13th Malaysia’s General Elections held in 2013,
it was observed that large numbers of urban constituencies saw
strongly decisive young voters (between 21-39 age group) determine
the outcome in their favour. Also, the Elections Commission had
approximated that 70% of some 4.2 million unregistered voters at the
time were citizens aged between 21 and 40 years old. If they are not
already considered an important form of political leverage, 450,000
young Malaysians turn 21 years old each year. Further compounding
this fact were the 2.4 million new voters registered in 2012, which at
the time constituted almost 30% of the entire voting population. This
article discusses the importance of issues for the youth, with
reference to the university students in Malaysia in their decision
making on polling day.
Abstract: This research paper aims to identify, analyze and rank
factors affecting labor productivity in Spain with respect to their
relative importance. Using a selected set of 35 factors, a structured
questionnaire survey was utilized as the method to collect data from
companies. Target population is comprised by a random
representative sample of practitioners related with the Spanish
construction industry. Findings reveal the top five ranked factors are
as follows: (1) shortage or late supply of materials; (2) clarity of the
drawings and project documents; (3) clear and daily task assignment;
(4) tools or equipment shortages; (5) level of skill and experience of
laborers. Additionally, this research also pretends to provide simple
and comprehensive recommendations so that they could be
implemented by construction managers for an effective management
of construction labor forces.
Abstract: An analysis of the Australian Diabetes Screening
Study estimated undiagnosed diabetes mellitus [DM] prevalence in a
high risk general practice based cohort. DM prevalence varied from
9.4% to 18.1% depending upon the diagnostic criteria utilised with
age being a highly significant risk factor. Utilising the gold standard
oral glucose tolerance test, the prevalence of DM was 22-23% in
those aged >= 70 years and
Abstract: With the rapid progress of modern cities, the railway
construction must be developing quickly in China.As a typical
high-density country, shopping center on the subway should be one
important factor during the process of urban development. The paper
discusses the influence of the layout of shopping center on the subway,
and put it in the time and space’s axis of Shanghai urban development.
We usethe digital technology to establish the database of relevant
information. And then get the change role about shopping center on
subway in Shanghaiby the Kernel density estimate.The result shows
the development of shopping center on subway has a relationship with
local economic strength, population size, policysupport, and city
construction. And the suburbanization trend of shopping center would
be increasingly significant.By this case research, we could see the
Kernel density estimate is an efficient analysis method on the spatial
layout. It could reveal the characters of layout form of shopping center
on subway in essence. And it can also be applied to the other research
of space form.
Abstract: The ever increasing amount of solid waste (SW)
generated which is exacerbated by lack of proper waste management
system is of growing concern worldwide and in major cities in
developing countries due to its social, economic and environmental
implications. This study attempts to describe the aspects of solid
waste management (SWM) in Adama, one of the fast urbanizing
cities in Ethiopia, and highlights the challenges thereof. Data were
gathered through interview supplemented by field observation and
self-administered questionnaire. Then, the data were analyzed using
the Statistical Package for Social Science (SPSS) software. In
addition, secondary data were gathered from documents. Findings
revealed that the current SWM practice couldn’t cope with the fast
urbanizing needs and the rapid population growth exhibited by the
city. Besides, major factors contributing to the inefficient system
were identified. The study would provide practical insights to
decision makers in developing a sustainable SWM system leading to
minimized risk in the city.
Abstract: Multipotent mesenchymal stromal cells (MSCs)
possess immunomodulatory properties. The effect of MSCs on the
crucial cellular immunity compartment – T-cells is of a special
interest. It is known that MSC tissue niche and expected milieu of
their interaction with T- cells are characterized by low oxygen
concentration, whereas the in vitro experiments usually are carried
out at a much higher ambient oxygen (20%). We firstly evaluated
immunomodulatory effects of MSCs on T-cells at tissue-related
oxygen (5%) after interaction implied cell-to-cell contacts and
paracrine factors only. It turned out that MSCs under reduced oxygen
can effectively suppress the activation and proliferation of PHAstimulated
T-cells and can provoke decrease in the production of
proinflammatory and increase in anti-inflammatory cytokines. In
hypoxia some effects were amplified (inhibition of proliferation, antiinflammatory
cytokine profile shift). This impact was more evident
after direct cell-to-cell interaction; lack of intercellular contacts could
revoke the potentiating effect of hypoxia.
Abstract: Second line antiretroviral therapy (ART) regimen is
used when patients fail their first line regimen. There are many
factors such as non-adherence, drug resistance as well as virological
and immunological failure that lead to second line highly active
antiretroviral therapy (HAART) regimen treatment failure. This study
was aimed at determining predictor factors to treatment failure with
second line HAART and analyzing median survival time.
An observational, retrospective study was conducted in Sungai
Buloh Hospital (HSB) to assess current status of HIV patients treated
with second line HAART regimen. Convenience sampling was used
and 104 patients were included based on the study’s inclusion and
exclusion criteria. Data was collected for six months i.e. from July
until December 2013. Data was then analysed using SPSS version 18.
Kaplan-Meier and Cox regression analyses were used to measure
median survival times and predictor factors for treatment failure.
The study population consisted mainly of male subjects, aged 30-
45 years, who were heterosexual, and had HIV infection for less than
6 years. The most common second line HAART regimen given was
lopinavir/ritonavir (LPV/r)-based combination. Kaplan-Meier
analysis showed that patients on LPV/r demonstrated longer median
survival times than patients on indinavir/ritonavir (IDV/r) based
combination (p
Abstract: Climate change and poverty are global issues which cannot be waved aside in welfare of the ever increasing population. The causes / consequences are far more elaborate in developing countries, including Nigeria, which poses threats to the existence of man and his environment. The dominant role of agriculture makes it obvious that even minor climate deteriorations can cause devastating socio-economic consequences. Policies to curb the climate change by reducing the consumption of fossil fuels like oil, gas or carbon compounds have significant economical impacts on the producers/suppliers of these fuels. Thus a unified political narrative that advances both agendas is needed, because their components of an environmental coin that needs to be addressed. The developed world should maintain a low-carbon growth & real commitment of 0.7% of gross national income, as aid to developing countries & renewable energy approach should be emphasized, hence global poverty combated.
Abstract: In recent years in Italy the progress of the automobile industry, in the field of reduction of emissions values, is very remarkable. Nevertheless their evaluation and reduction is a key problem, especially in the cities, that account for more than 50% of world population. In this paper we dealt with the problem of describing a quantitatively approach for the reconstruction of GPS coordinates and altitude, in the context of correlation study between driving cycles / emission / geographical location, during an experimental campaign realized with some instrumented cars.
Abstract: A continuous time model of the interaction between
crop insect pests and naturally beneficial pest enemies is created
using a set of simultaneous, non-linear, ordinary differential
equations incorporating natural death rates based on the Weibull
distribution. The crop pest is present in all its life-cycle stages of:
egg, larva, pupa and adult. The beneficial insects, parasitoid wasps,
may be present in either or all parasitized: eggs, larva and pupa.
Population modelling is used to estimate the quantity of the natural
pest enemies that should be introduced into the pest infested
environment to suppress the pest population density to an
economically acceptable level within a prescribed number of days.
The results obtained illustrate the effect of different combinations of
parasitoid wasps, using the Pascal distribution to estimate their
success in parasitizing different pest developmental stages, to deliver
pest control to a sustainable level. Effective control, within a
prescribed number of days, is established by the deployment of two
or all three species of wasps, which partially destroy pest: egg, larvae
and pupae stages. The selected scenarios demonstrate effective
sustainable control of the pest in less than thirty days.
Abstract: Sustainable tall buildings that provide comfortable,
healthy and efficient indoor environments are clearly desirable as the
densification of living and working space for the world’s increasing
population proceeds. For environmental concerns, these buildings
must also be energy efficient. One component of these tasks is the
provision of indoor air quality and thermal comfort, which can be
enhanced with natural ventilation by the supply of fresh air. Working
spaces can only be naturally ventilated with connections to the
outdoors utilizing operable windows, double facades, ventilation
stacks, balconies, patios, terraces and skygardens. Large amounts of
fresh air can be provided to the indoor spaces without mechanical
air-conditioning systems, which are widely employed in
contemporary tall buildings.
This paper tends to present the concept of natural ventilation for
sustainable tall office buildings in order to achieve healthy and
comfortable working spaces, as well as energy efficient
environments. Initially the historical evolution of ventilation
strategies for tall buildings is presented, beginning with natural
ventilation and continuing with the introduction of mechanical airconditioning
systems. Then the emergence of natural ventilation due
to the health and environmental concerns in tall buildings is handled,
and the strategies for implementing this strategy are revealed. In the
next section, a number of case studies that utilize this strategy are
investigated. Finally, how tall office buildings can benefit from this
strategy is discussed.
Abstract: This study has only one objective which is to identify the different in factors of choosing the distributor for food and non-food OTOP entrepreneur in Thailand. In this research, the types of OTOP product will be divided into two groups which are food and non-food. The sample for the food type OTOP product was the processed fruit and vegetable from Nakorn Pathom province and the sample for the non-food type OTOP product was the court doll from Ang Thong province. The research was divided into 3 parts which were a study of the distribution pattern and how to choose the distributor of the food type OTOP product, a study of the distribution pattern and how to choose the distributor of the non-food type OTOP product and a comparison between 2 types of products to find the differentiation in the factor of choosing distributor. The data and information was collected by using the interview. The populations in the research were 5 producers of the processed fruit and vegetable from Nakorn Pathom province and 5 producers of the court doll from Ang Thong province. The significant factor in choosing the distributor of the food type OTOP product is the material handling efficiency and on-time delivery but for the non-food type OTOP product is focused on the channel of distribution and cost of the distributor.
Abstract: The work presented in this paper was performed for a workstation of an assembly section in a company that manufactures radio modules and air conditioning for cars. After performing a workstation analysis and a questionnaire to the operators it was possible to understand the need to investigate the risk of musculoskeletal disorders originated from both the handling of loads as the incorrect dimensioning of the workstation. Regarding the handling of loads the NIOSH Equation was used and it was verified that there was no risk of musculoskeletal disorders. As the operators expressed their lack of satisfaction regarding back pains due to posture adopted they were established the appropriate dimensions (to satisfy 97.5% of the population and using the table of anthropometric data of the Portuguese population) for the workstation and it was proposed the availability of a chair for the workers.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.