Abstract: The present study is an analysis of the forced convection heat transfer in porous channel with an oriented jet at the inlet with uniform velocity and temperature distributions. The upper wall is insulated when the bottom one is kept at constant temperature higher than that of the fluid at the entrance. The dynamic field is analysed by the Brinkman-Forchheimer extended Darcy model and the thermal field is traduced by the energy one equation model. The numerical solution of the governing equations is obtained by using the finite volume method. The results mainly concern the effect of Reynolds number, jet angle and thermal conductivity ratio on the flow structure and local and average Nusselt numbers evolutions.
Abstract: A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: In recent years, many researchers are involved in the
field of fuzzy theory. However, there are still a lot of issues to be
resolved. Especially on topics related to controller design such as the
field of robot, artificial intelligence, and nonlinear systems etc.
Besides fuzzy theory, algorithms in swarm intelligence are also a
popular field for the researchers. In this paper, a concept of utilizing
one of the swarm intelligence method, which is called Bacterial-GA
Foraging, to find the stabilized common P matrix for the fuzzy
controller system is proposed. An example is given in in the paper, as
well.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources.
The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: A forecasting model for steel demand uncertainty in Thailand is proposed. It consists of trend, autocorrelation, and outliers in a hierarchical Bayesian frame work. The proposed model uses a cumulative Weibull distribution function, latent first-order autocorrelation, and binary selection, to account for trend, time-varying autocorrelation, and outliers, respectively. The Gibbs sampling Markov Chain Monte Carlo (MCMC) is used for parameter estimation. The proposed model is applied to steel demand index data in Thailand. The root mean square error (RMSE), mean absolute percentage error (MAPE), and mean absolute error (MAE) criteria are used for model comparison. The study reveals that the proposed model is more appropriate than the exponential smoothing method.
Abstract: We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.