Method of Parameter Calibration for Error Term in Stochastic User Equilibrium Traffic Assignment Model

Stochastic User Equilibrium (SUE) model is a widely used traffic assignment model in transportation planning, which is regarded more advanced than Deterministic User Equilibrium (DUE) model. However, a problem exists that the performance of the SUE model depends on its error term parameter. The objective of this paper is to propose a systematic method of determining the appropriate error term parameter value for the SUE model. First, the significance of the parameter is explored through a numerical example. Second, the parameter calibration method is developed based on the Logit-based route choice model. The calibration process is realized through multiple nonlinear regression, using sequential quadratic programming combined with least square method. Finally, case analysis is conducted to demonstrate the application of the calibration process and validate the better performance of the SUE model calibrated by the proposed method compared to the SUE models under other parameter values and the DUE model.

A Video-Based Observation and Analysis Method to Assess Human Movement and Behaviour in Crowded Areas

Human movement in the real world provides important information for developing human behaviour models and simulations. However, it is difficult to assess ‘real’ human behaviour since there is no established method available. As part of the AUNTSUE (Accessibility and User Needs in Transport – Sustainable Urban Environments) project, this research aimed to propose a method to assess human movement and behaviour in crowded areas. The method is based on the three major steps of video recording, conceptual behavior modelling and video analysis. The focus is on individual human movement and behaviour in normal situations (panic situations are not considered) and the interactions between individuals in localized areas. Emphasis is placed on gaining knowledge of characteristics of human movement and behaviour in the real world that can be modelled in the virtual environment.

Using Trip Planners in Developing Proper Transportation Behavior

The article discusses multimodal mobility in contemporary societies as a main planning and organization issue in the functioning of administrative bodies, a problem which really exists in the space of contemporary cities in terms of shaping modern transport systems. The article presents classification of available resources and initiatives undertaken for developing multimodal mobility. Solutions can be divided into three groups of measures – physical measures in the form of changes of the transport network infrastructure, organizational ones (including transport policy) and information measures. The latter ones include in particular direct support for people travelling in the transport network by providing information about ways of using available means of transport. A special measure contributing to this end is a trip planner. The article compares several selected planners. It includes a short description of the Green Travelling Project, which aims at developing a planner supporting environmentally friendly solutions in terms of transport network operation. The article summarizes preliminary findings of the project.

Synthesis of New Bio-Based Solid Polymer Electrolyte Polyurethane-LiClO4 via Prepolymerization Method: Effect of NCO/OH Ratio on Their Chemical, Thermal Properties and Ionic Conductivity

Novel bio-based polymer electrolyte was synthesized with LiClO4 as the main source of charge carrier. Initially, polyurethane-LiClO4 polymer electrolytes were synthesized via prepolymerization method with different NCO/OH ratios and labelled them as PU1, PU2, PU3 and PU4. Fourier transform infrared (FTIR) analysis indicates the co-ordination between Li+ ion and polyurethane in PU1. Differential scanning calorimetry (DSC) analysis indicates PU1 has the highest glass transition temperature (Tg) corresponds to the most abundant urethane group which is the hard segment in PU1. Scanning electron microscopy (SEM) shows the good miscibility between lithium salt and the polymer. The study found that PU1 possessed the greatest ionic conductivity and the lowest activation energy, Ea. All the polyurethanes exhibited linear Arrhenius variations indicating ion transport via simple lithium ion hopping in polyurethane. This research proves the NCO content in polyurethane plays an important role in affecting the ionic conductivity of this polymer electrolyte.

A New Method for Estimating the Mass Recession Rate for Ablator Systems

As the human race will continue to explore the space by creating new space transportation means and sending them to other planets, the enhance of atmospheric reentry study is crucial. In this context, an analysis of mass recession rate of ablative materials for thermal shields of reentry spacecrafts is important to be carried out. The paper describes a new estimation method for calculating the mass recession of an ablator system made of carbon fiber reinforced plastic materials. This method is based on Arrhenius equation for low temperatures and, for high temperatures, on a theory applied for the recession phenomenon of carbon fiber reinforced plastic materials, theory which takes into account the presence of the resin inside the materials. The space mission of USERS spacecraft is considered as a case study.

Financial Analysis of Feasibility for a Heat Utilization System Using Rice Straw Pellets - Heating Energy Demand and the Collection and Storage Method in Nanporo, Japan

Rice straw pellets are a promising fuel as a renewable energy source. Financial analysis is needed to make a utilization system using rise straw pellets financially feasible, considering all regional conditions including stakeholders related to the collection and storage, production, transportation and heat utilization. We conducted the financial analysis of feasibility for a heat utilization system using rice straw pellets which has been developed for the first time in Nanporo, Hokkaido, Japan. Especially, we attempted to clarify the effect of factors required for the system to be financial feasibility, such as the heating energy demand and collection and storage method of rice straw. The financial feasibility was found to improve when increasing the heating energy demand and collecting wheat straw in August separately from collection of rice straw in November because the costs of storing rice straw and producing pellets were reduced. However, the system remained financially unfeasible. This study proposed a contractor program funded by a subsidy from Nanporo local government where a contracted company, instead of farmers, collects and transports rice straw in order to ensure the financial feasibility of the system, contributing to job creation in the region.

Chloride Transport in Ultra High Performance Concrete

Chloride resistance in Ultra High Performance Concrete (UHPC) is determined in this paper. This work deals with the one dimension chloride transport, which can be potentially dangerous particularly for the durability of concrete structures. Risk of reinforcement corrosion due to exposure to the concrete surface to direct the action of chloride ions (mainly in the form de-icing salts or groundwater) is dangerously increases. The measured data are investigated depending on the depth of penetration of chloride ions into the concrete structure. Comparative measurements with normal strength concrete are done as well. The experimental results showed that UHCP have improved resistance of chlorides penetration than NSC and also chloride diffusion depth is significantly lower in UHCP.

Using Probe Person Data for Travel Mode Detection

Recently GPS data is used in a lot of studies to automatically reconstruct travel patterns for trip survey. The aim is to minimize the use of questionnaire surveys and travel diaries so as to reduce their negative effects. In this paper data acquired from GPS and accelerometer embedded in smart phones is utilized to predict the mode of transportation used by the phone carrier. For prediction, Support Vector Machine (SVM) and Adaptive boosting (AdaBoost) are employed. Moreover a unique method to improve the prediction results from these algorithms is also proposed. Results suggest that the prediction accuracy of AdaBoost after improvement is relatively better than the rest.

Production of 3-Methyl-1-Butanol by Yeast Wild Strain

The biomass-based fuels have become great concern in order to replace the petroleum-based fuels. Biofuels are a wide range of fuels referred to liquid, gas and solid fuels produced from biomass. Recently, higher chain alcohols such as 3-methyl-1-butanol and isobutanol have become a better candidate compared to bioethanol in order to replace gasoline as transportation fuel. Therefore, in this study, 3-methyl-1-butanol was produced through a fermentation process by yeast. Several types of yeast involved in this research including Saccharomyces cerevisiae, Kluyveromyces lactis GG799 and Pichia pastoris (KM71H, GS115 and X33). The result obtained showed that K. lactis GG799 gave the highest concentration of 3-methyl-1-butanol at 274 mg/l followed by S. cerevisiae, P. pastoris GS115, P. pastoris KM71H and P. pastoris X33 at 265 mg/l, 190 mg/l, 182 mg/l and 174 mg/l respectively. Based on the result, it proved that yeast have a potential in producing 3-methyl-1-butanol naturally.

Oil-Water Two-Phase Flow Characteristics in Horizontal Pipeline – A Comprehensive CFD Study

In the present work, detailed analysis on flow characteristics of a pair of immiscible liquids through horizontal pipeline is simulated by using ANSYS FLUENT 6.2. Moderately viscous oil and water (viscosity ratio = 107, density ratio = 0.89 and interfacial tension = 0.024 N/m) have been taken as system fluids for the study. Volume of Fluid (VOF) method has been employed by assuming unsteady flow, immiscible liquid pair, constant liquid properties, and co-axial flow. Meshing has been done using GAMBIT. Quadrilateral mesh type has been chosen to account for the surface tension effect more accurately. From the grid independent study, we have selected 47037 number of mesh elements for the entire geometry. Simulation successfully predicts slug, stratified wavy, stratified mixed and annular flow, except dispersion of oil in water, and dispersion of water in oil. Simulation results are validated with horizontal literature data and good conformity is observed. Subsequently, we have simulated the hydrodynamics (viz., velocity profile, area average pressure across a cross section and volume fraction profile along the radius) of stratified wavy and annular flow at different phase velocities. The simulation results show that in the annular flow, total pressure of the mixture decreases with increase in oil velocity due to the fact that pipe cross section is completely wetted with water. Simulated oil volume fraction shows maximum at the centre in core annular flow, whereas, in stratified flow, maximum value appears at upper side of the pipeline. These results are in accord with the actual flow configuration. Our findings could be useful in designing pipeline for transportation of crude oil.

The Application of Dynamic Network Process to Environment Planning Support Systems

In recent years, in addition to face the external threats such as energy shortages and climate change, traffic congestion and environmental pollution have become anxious problems for many cities. Considering private automobile-oriented urban development had produced many negative environmental and social impacts, the transit-oriented development (TOD) has been considered as a sustainable urban model. TOD encourages public transport combined with friendly walking and cycling environment designs, however, non-motorized modes help improving human health, energy saving, and reducing carbon emissions. Due to environmental changes often affect the planners’ decision-making; this research applies dynamic network process (DNP) which includes the time dependent concept to promoting friendly walking and cycling environmental designs as an advanced planning support system for environment improvements. This research aims to discuss what kinds of design strategies can improve a friendly walking and cycling environment under TOD. First of all, we collate and analyze environment designing factors by reviewing the relevant literatures as well as divide into three aspects of “safety”, “convenience”, and “amenity” from fifteen environment designing factors. Furthermore, we utilize fuzzy Delphi Technique (FDT) expert questionnaire to filter out the more important designing criteria for the study case. Finally, we utilized DNP expert questionnaire to obtain the weights changes at different time points for each design criterion. Based on the changing trends of each criterion weight, we are able to develop appropriate designing strategies as the reference for planners to allocate resources in a dynamic environment. In order to illustrate the approach we propose in this research, Taipei city as one example has been used as an empirical study, and the results are in depth analyzed to explain the application of our proposed approach.

Sustainability as a Criterion in the Reconstruction of Libya’s Public Transport Infrastructure

Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Tribological Investigation and the Effect of Karanja Biodiesel on Engine Wear in Compression Ignition Engine

Various biomass based resources, which can be used as an extender, or a complete substitute of diesel fuel may have very significant role in the development of agriculture, industrial and transport sectors in the energy crisis. Use of Karanja oil methyl ester biodiesel in a CI DI engine was found highly compatible with engine performance along with lower exhaust emission as compared to diesel fuel but with slightly higher NOx emission and low wear characteristics. The combustion related properties of vegetable oils are somewhat similar to diesel oil. Neat vegetable oils or their blends with diesel, however, pose various long-term problems in compression ignition engines. These undesirable features of vegetable oils are because of their inherent properties like high viscosity, low volatility, and polyunsaturated character. Pongamia methyl ester (PME) was prepared by transesterification process using methanol for long term engine operations. The physical and combustion-related properties of the fuels thus developed were found to be closer to that of the diesel. A neat biodiesel (PME) was selected as a fuel for the tribological study of biofuels. Two similar new engines were completely disassembled and subjected to dimensioning of various vital moving parts and then subjected to long-term endurance tests on neat biodiesel and diesel respectively. After completion of the test, both the engines were again disassembled for physical inspection and wear measurement of various vital parts. The lubricating oil samples drawn from both engines were subjected to atomic absorption spectroscopy (AAS) for measurement of various wear metal traces present. The additional lubricating property of biodiesel fuel due to higher viscosity as compared to diesel fuel resulted in lower wear of moving parts and thus improved the engine durability with a bio-diesel fuel. Results reported from AAS tests confirmed substantially lower wear and thus improved life for biodiesel operated engines.

Evaluation Performance of PID, LQR, Pole Placement Controllers for Heat Exchanger

In industrial environments, the heat exchanger is a necessary component to any strategy of energy conversion. Much of thermal energy used in industrial processes passes at least one times by a heat exchanger, and methods systems recovering thermal energy. This survey paper tries to presents in a systemic way an sample control of a heat exchanger by comparison between three controllers LQR (linear quadratic regulator), PID (proportional, integrator and derivate) and Pole Placement. All of these controllers are used mainly in industrial sectors (chemicals, petrochemicals, steel, food processing, energy production, etc…) of transportation (automotive, aeronautics), but also in the residential sector and tertiary (heating, air conditioning, etc...) The choice of a heat exchanger, for a given application depends on many parameters: field temperature and pressure of fluids, and physical properties of aggressive fluids, maintenance and space. It is clear that the fact of having an exchanger appropriate, well-sized, well made and well used allows gain efficiency and energy processes.

Analyzing Defects with Failure Assessment Diagrams of Gas Pipelines

The approach in analyzing defects on different pipe lines is conducted through Failure Assessment Diagram (FAD). These methods of analyses have further extended in recent years. This approach is used to identify and stress out a solution for the defects which randomly occur with gas pipes such are corrosion defects, gauge defects, and combination of defects where gauge and dents are included. Few of the defects are to be analyzed in this paper where our main focus will be the fracture of cast Iron pipes, elastic-plastic failure and plastic collapse of X52 steel pipes for gas transport. We need to conduct a calculation of probability of the defects in order to predict and avoid such costly defects.

Optimization of Energy Harvesting Systems for RFID Applications

To avoid battery assisted tags with limited lifetime batteries, it is proposed here to replace them by energy harvesting systems, able to feed from local environment. This would allow total independence to RFID systems, very interesting for applications where tag removal from its location is not possible. Example is here described for luggage safety in airports, and is easily  extendable to similar situation in terms of operation constraints. The idea is to fix RFID tag with energy harvesting system not only to identify luggage but also to supply an embedded microcontroller with a sensor delivering luggage weight making it impossible to add or to remove anything from the luggage during transit phases. The aim is to optimize the harvested energy for such RFID applications, and to study in which limits these applications are theoretically possible. Proposed energy harvester is based on two energy sources: piezoelectricity and electromagnetic waves, so that when the luggage is moving on ground transportation to airline counters, the piezo module supplies the tag and its microcontroller, while the RF module operates during luggage transit thanks to readers located along the way. Tag location on the luggage is analyzed to get best vibrations, as well as harvester better choice for optimizing the energy supply depending on applications and the amount of energy harvested during a period of time. Effects of system parameters (RFID UHF frequencies, limit distance between the tag and the antenna necessary to harvest energy, produced voltage and voltage threshold) are discussed and working conditions for such system are delimited.

Risk Management and Security Practice in Customs Supply Chain: Application of Cross ABC Method to the Moroccan Customs

It is widely assumed that the case of Customs Supply Chain is classified as a complex system, due to not only the variety and large number of actors, but also their complex structural links, and the interactions between these actors, that’s why this system is subject to various types of Risks. The economic, political and social impacts of those risks are highly detrimental to countries, businesses and the public, for this reason, Risk management in the customs supply chain is becoming a crucial issue to ensure the sustainability, security and safety. The main characteristic of customs risk management approach is determining which goods and means of transport should be examined? To what extend? And where future compliance resources should be directed? The purposes of this article are, firstly to deal with the concept of customs supply chain, secondly present our risk management approach based on Cross Activity Based Costing (ABC) Method as an interactive tool to support decision making in customs risk management. Finally, analysis of case study of Moroccan customs to putting theory into practice and will thus draw together the various elements of a structured and efficient risk management approach.

The Study of Cost Accounting in S Company Based On TDABC

Third-party warehousing logistics has an important role in the development of external logistics. At present, the third-party logistics in our country is still a new industry, the accounting system has not yet been established, the current financial accounting system of third-party warehousing logistics is mainly in the traditional way of thinking, and only able to provide the total cost information of the entire enterprise during the accounting period, unable to reflect operating indirect cost information. In order to solve the problem of third-party logistics industry cost information distortion, improve the level of logistics cost management, the paper combines theoretical research and case analysis method to reflect cost allocation by building third-party logistics costing model using Time-Driven Activity-Based Costing(TDABC), and takes S company as an example to account and control the warehousing logistics cost.Based on the idea of “Products consume activities and activities consume resources”, TDABC put time into the main cost driver and use time-consuming equation resources assigned to cost objects. In S company, the objects focuses on three warehouse, engaged with warehousing and transportation (the second warehouse, transport point) service. These three warehouse respectively including five departments, Business Unit, Production Unit, Settlement Center, Security Department and Equipment Division, the activities in these departments are classified by in-out of storage forecast, in-out of storage or transit and safekeeping work. By computing capacity cost rate, building the time-consuming equation, the paper calculates the final operation cost so as to reveal the real cost.The numerical analysis results show that the TDABC can accurately reflect the cost allocation of service customers and reveal the spare capacity cost of resource center, verifies the feasibility and validity of TDABC in third-party logistics industry cost accounting. It inspires enterprises focus on customer relationship management and reduces idle cost to strengthen the cost management of third-party logistics enterprises.

The Impact of Rapid Urbanisation on Public Transport Systems in the Gauteng Region of South Africa

This paper seeks to illustrate the impact of rapid urbanization (in terms of both increase in people and vehicles) in the Gauteng region (which includes Johannesburg, Pretoria and Ekurhuleni). The impact that existing transport systems and options place on the capacity of residents from low income areas to travel and conduct various socio-economic activities is discussed. The findings are drawn from a 2013 analysis of a random transport household survey of 1550 households carried out in Gauteng province. 91.4% of the study respondents had access to public transport, while 8.6% had no access to public transport. Of the 91.4% who used public transport, the main reason used to explain this state of affairs was that it was affordable (54.3%), convenient (15.9%), Accessible (11.9%), lack of alternatives (6.4%) and reliable at 4.1%. Recommendations advanced revolve around the need to reverse land use and transportation effects of apartheid planning, growing and developing a sustainable critical mass of public transport interventions supported by appropriate transport systems that are environmentally sustainable through proper governance. 38.5% of the respondents indicated that developing compact, smart and integrated urban land spaces was key to reducing travel challenges in the study area. 23.4% indicated that the introduction and upgrading of BRT buses to cover all areas in the study area was a step in the right direction because it has great potential in shifting travel patterns to favor public modes of transport. 15.1% indicated that all open spaces should be developed so that fragmentation of land uses can be addressed. This would help to fight disconnected and fragmented space and trip making challenges in Gauteng. 13.4% indicated that improving the metro rail services was critical since this is a mass mover of commuters. 9.6% of the respondents highlighted that the bus subsidy policy has to be retained in the short to medium term since the spatial mismatches and challenges created by apartheid are yet to be fully reversed.