Abstract: Climate change will affect the hydrological cycle in
many different ways such as increase in evaporation and rainfalls.
There have been growing interests among researchers to identify the
nature of trends in historical rainfall data in many different parts of
the world. This paper examines the trends in annual maximum
rainfall data from 30 stations in New South Wales, Australia by using
two non-parametric tests, Mann-Kendall (MK) and Spearman’s Rho
(SR). Rainfall data were analyzed for fifteen different durations
ranging from 6 min to 3 days. It is found that the sub-hourly
durations (6, 12, 18, 24, 30 and 48 minutes) show statistically
significant positive (upward) trends whereas longer duration (subdaily
and daily) events generally show a statistically significant
negative (downward) trend. It is also found that the MK test and SR
test provide notably different results for some rainfall event durations
considered in this study. Since shorter duration sub-hourly rainfall
events show positive trends at many stations, the design rainfall data
based on stationary frequency analysis for these durations need to be
adjusted to account for the impact of climate change. These shorter
durations are more relevant to many urban development projects
based on smaller catchments having a much shorter response time.
Abstract: Supermarkets are the most electricity-intensive type of
commercial buildings. The unsuitable indoor environment of a
supermarket provided by abnormal HVAC operations incurs waste
energy consumption in refrigeration systems. This current study
briefly describes significantly solid backgrounds and proposes easyto-
use analysis terminology for investigating the impact of HVAC
operations on refrigeration power consumption using the field-test
data obtained from building automation system (BAS). With solid
backgrounds and prior knowledge, expected energy interactions
between HVAC and refrigeration systems are proposed through
Pearson’s correlation analysis (R value) by considering correlations
between equipment power consumption and dominantly independent
variables (driving force conditions).The R value can be conveniently
utilized to evaluate how strong relations between equipment
operations and driving force parameters are. The calculated R values
obtained from field data are compared to expected ranges of R values
computed by energy interaction methodology. The comparisons can
separate the operational conditions of equipment into faulty and
normal conditions. This analysis can simply investigate the condition
of equipment operations or building sensors because equipment could
be abnormal conditions due to routine operations or faulty
commissioning processes in field tests. With systematically solid and
easy-to-use backgrounds of interactions provided in the present
article, the procedures can be utilized as a tool to evaluate the proper
commissioning and routine operations of HVAC and refrigeration
systems to detect simple faults (e.g. sensors and driving force
environment of refrigeration systems and equipment set-point) and
optimize power consumption in supermarket buildings. Moreover,
the analysis will be used to further study the FDD research for
supermarkets in future.
Abstract: The psychological impact of peer influence on its
individual group members, can make them resist HIV/AIDS
counselling and testing. This study investigated the correlate of peer
influence and resistance to HIV/AIDS counselling and testing among
students in tertiary institutions in Kano state, Nigeria. To achieve
this, three null hypotheses were postulated and tested. Cross-
Sectional Survey Design was employed in which 1512 sample was
selected from a student population of 104,841.Simple Random
Sampling was used in the selection. A self-developed 20-item scale
called Peer Influence and Psychological Resistance Inventory
(PIPRI) was used for data collection. Pearson Product Moment
Correlation (PPMCC) via test-retest method was applied to estimate a
reliability coefficient of 0.86 for the scale. Data obtained was
analyzed using t-test and PPMCC at 0.05 level of confidence. Results
reveal 26.3% (397) of the respondents being influenced by their peer
group, while 39.8% showed resistance. Also, the t-tests and PPMCC
statistics were greater than their respective critical values. This shows
that there was a significant gender difference in peer influence and a
difference between peer influence and resistance to HIV/AIDS
counselling and testing. However, a positive relationship between
peer influence and resistance to HIV/AIDS counselling and testing
was shown. A major recommendation offered suggests the use of
reinforcement and social support for positive attitudes and
maintenance of safe behaviour among students who patronize
HIV/AIDS counselling.
Abstract: Climate change will affect various aspects of
hydrological cycle such as rainfall. A change in rainfall will affect
flood magnitude and frequency in future which will affect the design
and operation of hydraulic structures. In this paper, trends in subhourly,
sub-daily, and daily extreme rainfall events from 18 rainfall
stations located in Tasmania, Australia are examined. Two nonparametric
tests (Mann-Kendall and Spearman’s Rho) are applied to
detect trends at 10%, 5%, and 1% significance levels. Sub-hourly (6,
12, 18, and 30 minutes) annual maximum rainfall events have been
found to experience statistically significant upward trends at 10%
level of significance. However, sub-daily durations (1 hour, 3 and 12
hours) exhibit decreasing trends and no trends exists for longer
duration rainfall events (e.g. 24 and 72 hours). Some of the durations
(e.g. 6 minutes and 6 hours) show similar results (with upward
trends) for both the tests. For 12, 18, 60 minutes and 3 hours
durations both the tests show similar downward trends. This finding
has important implication for Tasmania in the design of urban
infrastructure where shorter duration rainfall events are more relevant
for smaller urban catchments such as parking lots, roof catchments
and smaller sub-divisions.
Abstract: The aim of present study was to monitor the presence
of Trichodina sp. in Rainbow trout, Oncorhynchus mykiss collected
from various fish farms in the western provinces of Iran during
January, 2013- January, 2014. Out of 675 sampled fish 335, (49.16%)
were infested with Trichodina. The highest prevalence was observed
in the spring and winter followed by autumn and summer. In general,
the intensity of infection was low except in cases where outbreaks of
Trichodiniasis endangered the survival of fish in some ponds. In light
infestation Trichodina is usually present on gills, fins and skin of
apparently healthy fish. Clinical signs of Trichodiniasis only appear
on fish with heavy infections and cases of moderate ones that are
usually exposed to one or more stress factors including, rough
handling during transportation from ponds, overcrowdness,
malnutrition, high of free ammonia and low of oxygen concentration.
Clinical signs of Trichodiniasis in sampled fish were sluggish
movement, loss of appetite, black coloration, necrosis and ulcer on
different parts of the body, detached scales and excessive
accumulation of mucous in gill pouches. The most obvious
histopathological changes in diseased fish were sloughing of the
epidermal layer, aggregation of leucocytes and melanine-carrying
cells (between the dermis and hypodermis) and proliferative changes
including hyperplasia and hypertrophy of the epithelial lining cells of
gill filaments which resulted in fusion of secondary lamellae. Control
of Trichodiniasis, has been achieved by formalin bath treatment at a
concentration of 250 ppm for one hour.
Abstract: The purpose of the present work is to review some
data for the management challenges that the aquaculture industry in
Greece is currently facing. The results indicate that Greek
aquaculture fish farms apply Human Resources Management (HRM)
practices which can increase motivation, commitment and job
satisfaction of their personnel. In turn, these practices can increase
the productivity of the business. The Greek fish farms appear to
invest in research and technological innovation with a good record in
research activities and the generation of patents. Interestingly, the
results of the present work were carried out during the period of the
recent economic crisis in Greece. Several sectors of the Greek
economy were severely affected by the financial problems of the
Greek government and the Greek banks. Under the adverse
economical conditions created by the Greek economic crisis, even the
Greek aquaculture industry, which historically is considered as a
thriving national exporting business sector, experienced harsh
economic and market conditions. As a result of the global, European
and national economic crisis, consumption of fish dropped while
companies had to hold most of their stocked fish in order to regulated
the flow to the market and the price. This occurred at a time where
Banks in Greece had their own financial crisis – banking crisis -
which resulted in limited access to lending for the all business sectors
of the national economy including the Greek aquaculture industry. In
spite of these economic conditions, the Greek aquaculture industry,
after a series of mergers and acquisitions, has now stabilized
production and exhibits very good prospects for future growth.
Evidently, the firms had to cut salaries and on some occasions even
pay their staff in arrears. Nevertheless, the results presented in this
paper indicate that during the economic crisis, the surveyed fish
farms maintained their HRM practices, investing in their human
capital and technological input. In fact, human capital and
technological input are the ticket for future success of companies in
any business sector.
Abstract: In the culture of Thailand, the Yak serve as a mediated
icon representing strength, power, and mystical protection not only
for the Buddha, but for population of worshipers. Originating from
the forests of China, the Yak continues to stand guard at the gates of
Buddhist temples. The Yak represents Thai culture in the hearts of
Thai people. This paper presents a qualitative study regarding the
curious mix of media, culture, and religion that projects the Yak of
Thailand as a larger than life message throughout the political,
cultural, and religious spheres. The gate guardians, or gods as they
are sometimes called, appear throughout the religious temples of
Asian cultures. However, the Asian cultures demonstrate differences
in artistic renditions (or presentations) of such sentinels. Thailand
gate guards (the Yak) stand in front of many Buddhist temples, and
these iconic figures display unique features with varied symbolic
significance. The temple (or wat), plays a vital role in every
community; and, for many people, Thailand’s temples are the
country’s most endearing sights. The authors applied folknography as
a methodology to illustrate the importance of the Thai Yak in serving
as meaningful icons that transcend not only time, but the culture,
religion, and mass media. The Yak represents mythical, religious,
artistic, cultural, and militaristic significance for the Thai people.
Data collection included interviews, focus groups, and natural
observations. This paper summarizes the perceptions of the Thai
people concerning their gate sentries and the relationship,
communication, connection, and the enduring respect that Thai
people hold for their guardians of the gates.
Abstract: Information and Communication Technologies (ICTs)
are pervasive nowadays, including in education where they are
expected to improve the performance of learners. However, the hope
placed in ICTs to find viable solutions to the problem of poor
academic performance in schools in the developing world has not yet
yielded the expected benefits. This problem serves as a motivation to
this study whose aim is to examine the perceptions of educators on
the advantages and disadvantages of e-learning. This aim will be
subdivided into two types of research objectives. Objectives on the
identification and design of theories and models will be achieved
using content analysis and literature review. However, the objective
on the empirical testing of such theories and models will be achieved
through the survey of educators from different schools in the
Pinetown District of the South African Kwazulu-Natal province.
SPSS is used to quantitatively analyse the data collected by the
questionnaire of this survey using descriptive statistics and Pearson
correlations after assessing the validity and the reliability of the data.
The main hypothesis driving this study is that there is a relationship
between the demographics of educators’ and their adherence to
learning theories on one side, and their perceptions on the advantages
and disadvantages of e-learning on the other side, as argued by
existing research; but this research views these learning theories
under three perspectives: educators’ adherence to self-regulated
learning, to constructivism, and to progressivism. This hypothesis
was fully confirmed by the empirical study except for the
demographic factor where teachers’ level of education was found to
be the only demographic factor affecting the perceptions of educators
on the advantages and disadvantages of e-learning.
Abstract: Ongoing landscape transformation is one of the major
causes behind disappearance of traditional landscapes, and lead to
species and resource loss. Tree in paddy fields in the northeast of
Thailand is one of those traditional landscapes. Using three different
historical time layers, we acknowledged the severe deforestation and
rapid urbanization happened in the region. Despite the general
thinking of decline in tree density as consequences, the heterogeneous
trend of changes in total tree density in three studied landscapes denied
the hypothesis that number of trees in paddy field depend on the length
of land use practice. On the other hand, due to selection of planting
new trees on levees, existence of trees in paddy field now relies on
their values for human use. Besides, changes in land use and landscape
structure had a significant impact on decision of which tree density
level is considered as suitable for the landscape.
Abstract: Copper being one of the major intrinsic residual
impurities in steel possesses the tendency to induce severe
microstructural distortions if not controlled within certain limits.
Hence, this paper investigates the effect of this element on the
mechanical properties of construction steel with a view to ascertain
its safe limits for effective control. The experiment entails collection
of statistically scheduled samples of hot rolled profiles with varied
copper concentrations in the range of 0.12-0.39 wt. %. From these
samples were prepared standard test specimens subjected to tensile,
impact, hardness and microstructural analyses. Results show a rather
huge compromise in mechanical properties as the specimens
demonstrated 54.3%, 74.2% and 64.9% reduction in tensile strength,
impact energy and hardness respectively as copper content increases
from 0.12 wt. % to 0.39 wt. %. The steel’s abysmal performance is
due to the severe distortion of the microstructure occasioned by the
development of incoherent complex compounds which weaken the
pearlite reinforcing phase. It is concluded that the presence of copper
above 0.22 wt. % is deleterious to construction steel performance.
Abstract: The paper presents combined automatic speech
recognition (ASR) of English and machine translation (MT) for
English and Croatian and Croatian-English language pairs in the
domain of business correspondence. The first part presents results of
training the ASR commercial system on English data sets, enriched
by error analysis. The second part presents results of machine
translation performed by free online tool for English and Croatian
and Croatian-English language pairs. Human evaluation in terms of
usability is conducted and internal consistency calculated by
Cronbach's alpha coefficient, enriched by error analysis. Automatic
evaluation is performed by WER (Word Error Rate) and PER
(Position-independent word Error Rate) metrics, followed by
investigation of Pearson’s correlation with human evaluation.
Abstract: The main objective of this study was to identify
factors and conditions that motivated and encouraged students
towards the math class and the factors that made this class an
attractive and lovely one. To do this end, questionnaires consisting of
15 questions were distributed among 85 math teachers working in
schools of Zahedan. Having collected and reviewed these
questionnaires, it was shown that doing activity in math class
(activity of students while teaching) and previous math teachers'
behaviors have had much impact on encouraging the students
towards mathematics. Separation of educational classroom of
mathematics from the main classroom (which is decorated with crafts
created by students themselves with regard to math book including
article, wall newspaper, figures and formulas), peers, size and
appearance of math book, first grade teachers in each educational
level, among whom the Elementary first grade teachers had more
importance and impact, were among the most influential and
important factors in this regard. Then, school environment, family,
conducting research related to mathematics, its application in daily
life and other courses and studying the history of mathematics were
categorized as important factors that would increase the students’
interest in mathematics.
Abstract: In the present work, detailed analysis on flow characteristics of a pair of immiscible liquids through horizontal pipeline is simulated by using ANSYS FLUENT 6.2. Moderately viscous oil and water (viscosity ratio = 107, density ratio = 0.89 and interfacial tension = 0.024 N/m) have been taken as system fluids for the study. Volume of Fluid (VOF) method has been employed by assuming unsteady flow, immiscible liquid pair, constant liquid properties, and co-axial flow. Meshing has been done using GAMBIT. Quadrilateral mesh type has been chosen to account for the surface tension effect more accurately. From the grid independent study, we have selected 47037 number of mesh elements for the entire geometry. Simulation successfully predicts slug, stratified wavy, stratified mixed and annular flow, except dispersion of oil in water, and dispersion of water in oil. Simulation results are validated with horizontal literature data and good conformity is observed. Subsequently, we have simulated the hydrodynamics (viz., velocity profile, area average pressure across a cross section and volume fraction profile along the radius) of stratified wavy and annular flow at different phase velocities. The simulation results show that in the annular flow, total pressure of the mixture decreases with increase in oil velocity due to the fact that pipe cross section is completely wetted with water. Simulated oil volume fraction shows maximum at the centre in core annular flow, whereas, in stratified flow, maximum value appears at upper side of the pipeline. These results are in accord with the actual flow configuration. Our findings could be useful in designing pipeline for transportation of crude oil.
Abstract: In the past, the most comprehensively adopted light
source was incandescent light bulbs, but with the appearance of LED
light sources, traditional light sources have been gradually replaced by
LEDs because of its numerous superior characteristics. However,
many of the standards do not apply to LEDs as the two light sources
are characterized differently. This also intensifies the significance of
studies on LEDs. As a Kansei design study investigating the visual
glare produced by traffic arrows implemented with LEDs, this study
conducted a semantic analysis on the styles of traffic arrows used in
domestic and international occasions. The results will be able to
reduce drivers’ misrecognition that results in the unsuccessful arrival
at the destination, or in traffic accidents. This study started with a
literature review and surveyed the status quo before conducting
experiments that were divided in two parts. The first part involved a
screening experiment of arrow samples, where cluster analysis was
conducted to choose five representative samples of LED displays. The
second part was a semantic experiment on the display of arrows using
LEDs, where the five representative samples and the selected ten
adjectives were incorporated. Analyzing the results with
Quantification Theory Type I, it was found that among the
composition of arrows, fletching was the most significant factor that
influenced the adjectives. In contrast, a “no fletching” design was
more abstract and vague. It lacked the ability to convey the intended
message and might bear psychological negative connotation including
“dangerous,” “forbidden,” and “unreliable.” The arrow design
consisting of “> shaped fletching” was found to be more concrete and
definite, showing positive connotation including “safe,” “cautious,”
and “reliable.” When a stimulus was placed at a farther distance, the
glare could be significantly reduced; moreover, the visual evaluation
scores would be higher. On the contrary, if the fletching and the shaft
had a similar proportion, looking at the stimuli caused higher
evaluation at a closer distance. The above results will be able to be
applied to the design of traffic arrows by conveying information
definitely and rapidly. In addition, drivers’ safety could be enhanced
by understanding the cause of glare and improving visual
recognizability.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Present research investigates eclecticism in Iranian
theatre on the basis of eclectic theory. Eclectic theatre is a new theory
in postmodernism. The theory appeared during 60th – 70th century in
some theatres such as “Conference of the Birds”.
Special theatrical forms have been developed in many
geographical- cultural areas of the world and are indigenous to that
area. These forms, as compared with original forms, are considered to
be traditional while being comprehensive, the form is considered to
be national. Kaboudan and Sfandiar theatre has been influenced by
elements of traditional form of Iran.