Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: A forecasting model for steel demand uncertainty in Thailand is proposed. It consists of trend, autocorrelation, and outliers in a hierarchical Bayesian frame work. The proposed model uses a cumulative Weibull distribution function, latent first-order autocorrelation, and binary selection, to account for trend, time-varying autocorrelation, and outliers, respectively. The Gibbs sampling Markov Chain Monte Carlo (MCMC) is used for parameter estimation. The proposed model is applied to steel demand index data in Thailand. The root mean square error (RMSE), mean absolute percentage error (MAPE), and mean absolute error (MAE) criteria are used for model comparison. The study reveals that the proposed model is more appropriate than the exponential smoothing method.
Abstract: A polypropylene hollow fiber membrane module is used for separating dissolved gases which contain dissolved oxygen from water. These dissolved gases can be used for underwater breathing. To be used for a human, the minimum amount of oxygen is essential. To increase separation of dissolved gases, much water and high surface area of hollow fibers are requested. For efficient separation system, performance of single membrane module with high surface area needs to be investigated.
In this study, we set up experimental devices for analyzing separation characteristics of dissolved gases including oxygen from water using a polypropylene hollow fiber membrane module. Separation of dissolved gases from water is investigated with variations of water flow rates. Composition of dissolved gases is also measured using GC. These results expect to be used in developing the portable separation system.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: Lately, with the increasing number of location-based applications, demand for highly accurate and reliable indoor localization became urgent. This is a challenging problem, due to the measurement variance which is the consequence of various factors like obstacles, equipment properties and environmental changes in complex nature of indoor environments. In this paper we propose low-cost custom-setup infrastructure solution and localization algorithm based on the Weighted Centroid Localization (WCL) method. Localization accuracy is increased by several enhancements: calibration of RSSI values gained from wireless nodes, repetitive measurements of RSSI to exclude deviating values from the position estimation, and by considering orientation of the device according to the wireless nodes. We conducted several experiments to evaluate the proposed algorithm. High accuracy of ~1m was achieved.
Abstract: An investigation of adaptable winglets for morphing
aircraft control and performance is described in this paper. The
concepts investigated consist of various winglet configurations
fundamentally centred on a baseline swept wing. The impetus for the
work was to identify and optimize winglets to enhance controllability
and the aerodynamic efficiency of a small unmanned aerial vehicle.
All computations were performed with Athena Vortex Lattice
modelling with varying degrees of twist, swept, and dihedral angle
considered. The results from this work indicate that if adaptable
winglets were employed on small scale UAV’s improvements in both
aircraft control and performance could be achieved.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.
Abstract: In this paper, we experimentally investigate the performance of an efficient high gain triple-pass L-band Erbium-Doped Fiber (EDF) amplifier structure with a single pump source. The amplifier gain and noise figure variation with EDF pump power, input signal power and wavelengths have been investigated. The generated backward Amplified Spontaneous Emission (ASE) noise of the first amplifier stage is suppressed by using a tunable band-pass filter. The amplifier achieves a signal gain of 55 dB with low noise figure of 3.8 dB at -50 dBm input signal power. The amplifier gain shows significant improvement of 12.8 dB compared to amplifier structure without ASE suppression.
Abstract: This paper presents the effect of electric field
distribution which is an electric field intensity analysis. Consideration
of the dielectric heating of grains and insects, the rice and rice
weevils are utilized for dielectric heating analysis. Furthermore, this
analysis compares the effect of electric field distribution in rice and
rice weevil. In this simulation, two copper plates are used to generate
the electric field for dielectric heating system and put the rice
materials between the copper plates. The simulation is classified in
two cases, which are case I one rice weevil is placed in the rice and
case II two rice weevils are placed at different position in the rice.
Moreover, the probes are located in various different positions on
plate. The power feeding on this plate is optimized by using CST EM
studio program of 1000 watt electrical power at 39 MHz resonance
frequency. The results of two cases are indicated that the most
electric field distribution and intensity are occurred on the rice and
rice weevils at the near point of the probes. Moreover, the heat is
directed to the rice weevils more than the rice. When the temperature
of rice and rice weevils are calculated and compared, the rice weevils
has the temperature more than rice is about 41.62 Celsius degrees.
These results can be applied for the dielectric heating applications to
eliminate insect.
Abstract: In this paper we deal with using Lego Mindstorms in
simulation of robotic systems with respect to cost reduction. Lego
Mindstorms kit contains broad variety of hardware components
which are required to simulate, program and test the robotics systems
in practice. Algorithm programming went in development
environment supplied together with Lego kit as in programming
language C# as well. Algorithm following the line, which we dealt
with in this paper, uses theoretical findings from area of controlling
circuits. PID controller has been chosen as controlling circuit whose
individual components were experimentally adjusted for optimal
motion of robot tracking the line. Data which are determined to
process by algorithm are collected by sensors which scan the
interface between black and white surfaces followed by robot. Based
on discovered facts Lego Mindstorms can be considered for low-cost
and capable kit to simulate real robotics systems.
Abstract: This paper presents breast cancer detection by
observing the specific absorption rate (SAR) intensity for
identification tumor location, the tumor is identified in coordinates
(x,y,z) system. We examined the frequency between 4-8 GHz to look
for the most appropriate frequency. Results are simulated in
frequency 4-8 GHz, the model overview include normal breast with
50 mm radian, 5 mm diameter of tumor, and ultra wideband (UWB)
bowtie antenna. The models are created and simulated in CST
Microwave Studio. For this simulation, we changed antenna to 5
location around the breast, the tumor can be detected when an
antenna is close to the tumor location, which the coordinate of
maximum SAR is approximated the tumor location. For reliable, we
experiment by random tumor location to 3 position in the same size
of tumor and simulation the result again by varying the antenna
position in 5 position again, and it also detectable the tumor position
from the antenna that nearby tumor position by maximum value of
SAR, which it can be detected the tumor with precision in all
frequency between 4-8 GHz.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: In recent years, the adoption of mobile phones has been exceptionally rapid in many parts of the world, and Tanzania is not exceptional. We are witnessing a number of new mobile network operators being licensed from time to time by Tanzania Communications Regulatory Authority (TCRA). This makes competition in the telecommunications market very stiff. All mobile phone companies are struggling to earn more new customers into their networks. This trend courses a stiff competition. The various measures are being taken by different companies including, lowering tariff, and introducing free short messages within and out of their networks, and free calls during off-peak periods. This paper is aimed at investigating the influence of tariffs on students’ mobile customers in selecting their mobile network operators. About seventy seven students from high learning institutions in Dodoma Municipality, Tanzania, participated in responding to the prepared questionnaires. The sought information was aimed at determining if tariffs influenced students into selection of their current mobile operators. The results indicate that tariffs were the major driving factor in selection of mobile operators. However, female mobile customers were found to be more easily attracted into subscribing to a mobile operator due to low tariffs, a bigger number of free short messages or discounted call charges than their fellow male customers.
Abstract: This paper presents a comparative study between two
neural network models namely General Regression Neural Network
(GRNN) and Back Propagation Neural Network (BPNN) are used
to estimate radial overcut produced during Electrical Discharge
Machining (EDM). Four input parameters have been employed:
discharge current (Ip), pulse on time (Ton), Duty fraction (Tau) and
discharge voltage (V). Recently, artificial intelligence techniques, as
it is emerged as an effective tool that could be used to replace
time consuming procedures in various scientific or engineering
applications, explicitly in prediction and estimation of the complex
and nonlinear process. The both networks are trained, and the
prediction results are tested with the unseen validation set of the
experiment and analysed. It is found that the performance of both the
networks are found to be in good agreement with average percentage
error less than 11% and the correlation coefficient obtained for the
validation data set for GRNN and BPNN is more than 91%. However,
it is much faster to train GRNN network than a BPNN and GRNN is
often more accurate than BPNN. GRNN requires more memory space
to store the model, GRNN features fast learning that does not require
an iterative procedure, and highly parallel structure. GRNN networks
are slower than multilayer perceptron networks at classifying new
cases.
Abstract: In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.