Abstract: The scope of this paper is to evaluate and compare the potential of LS-PV(Large Scale Photovoltaic Power Plant) power generation systems in the southern region of Libya at Al-Kufra for both stationary and tracking systems. A Microsoft Excel-VBA program has been developed to compute slope radiation, dew-point, sky temperature, and then cell temperature, maximum power output and module efficiency of the system for stationary system and for tracking system. The results for energy production show that the total energy output is 114GWh/year for stationary system and 148GWh/year for tracking system. The average module efficiency for the stationary system is 16.6% and 16.2% for the tracking system.
The values of electricity generation capacity factor (CF) and solar capacity factor (SCF) for stationary system were found to be 26% and 62.5% respectively and 34% and 82% for tracking system. The GCR (Ground Cover Ratio) for a stationary system is 0.7, which corresponds to a tilt angle of 24°. The GCR for tracking system was found to be 0.12. The estimated ground area needed to build a 50MW PV plant amounts to approx. 0.55km2 for a stationary PV field constituted by HIT PV arrays and approx. 91MW/ km2. In case of a tracker PV field, the required ground area amounts approx.2.4km2 and approx. 20.5MW/ km2.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: We installed solar panels and digital meteorological equipments whose electrical power is supplied using PV on July 13, 2011. Then, the relationship between the electric power generation and the irradiation, air temperature, and wind velocity was investigated on a roof at a university. The electrical power generation, irradiation, air temperature, and wind velocity were monitored over two years. By analyzing the measured meteorological data and electric power generation data using PTC, we calculated the size of the solar panel that is most suitable for this system. We also calculated the wasted power generation using PTC with the measured meteorological data obtained in this study. In conclusion, to reduce the "wasted power generation", a smaller-size solar panel is required for stable operation.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: In this paper a nonlinear feedback control called augmented automatic choosing control (AACC) for a class of
nonlinear systems with constrained input is presented. When designed
the control, a constant term which arises from linearization of a
given nonlinear system is treated as a coefficient of a stable zero
dynamics. Parameters of the control are suboptimally selected by
maximizing the stable region in the sense of Lyapunov with the aid
of a genetic algorithm. This approach is applied to a field excitation
control problem of power system to demonstrate the splendidness
of the AACC. Simulation results show that the new controller can
improve performance remarkably well.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.
Abstract: Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.
Abstract: In this paper, we experimentally investigate the performance of an efficient high gain triple-pass L-band Erbium-Doped Fiber (EDF) amplifier structure with a single pump source. The amplifier gain and noise figure variation with EDF pump power, input signal power and wavelengths have been investigated. The generated backward Amplified Spontaneous Emission (ASE) noise of the first amplifier stage is suppressed by using a tunable band-pass filter. The amplifier achieves a signal gain of 55 dB with low noise figure of 3.8 dB at -50 dBm input signal power. The amplifier gain shows significant improvement of 12.8 dB compared to amplifier structure without ASE suppression.
Abstract: This paper presents the effect of electric field
distribution which is an electric field intensity analysis. Consideration
of the dielectric heating of grains and insects, the rice and rice
weevils are utilized for dielectric heating analysis. Furthermore, this
analysis compares the effect of electric field distribution in rice and
rice weevil. In this simulation, two copper plates are used to generate
the electric field for dielectric heating system and put the rice
materials between the copper plates. The simulation is classified in
two cases, which are case I one rice weevil is placed in the rice and
case II two rice weevils are placed at different position in the rice.
Moreover, the probes are located in various different positions on
plate. The power feeding on this plate is optimized by using CST EM
studio program of 1000 watt electrical power at 39 MHz resonance
frequency. The results of two cases are indicated that the most
electric field distribution and intensity are occurred on the rice and
rice weevils at the near point of the probes. Moreover, the heat is
directed to the rice weevils more than the rice. When the temperature
of rice and rice weevils are calculated and compared, the rice weevils
has the temperature more than rice is about 41.62 Celsius degrees.
These results can be applied for the dielectric heating applications to
eliminate insect.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: This paper presents a comparative study between two
neural network models namely General Regression Neural Network
(GRNN) and Back Propagation Neural Network (BPNN) are used
to estimate radial overcut produced during Electrical Discharge
Machining (EDM). Four input parameters have been employed:
discharge current (Ip), pulse on time (Ton), Duty fraction (Tau) and
discharge voltage (V). Recently, artificial intelligence techniques, as
it is emerged as an effective tool that could be used to replace
time consuming procedures in various scientific or engineering
applications, explicitly in prediction and estimation of the complex
and nonlinear process. The both networks are trained, and the
prediction results are tested with the unseen validation set of the
experiment and analysed. It is found that the performance of both the
networks are found to be in good agreement with average percentage
error less than 11% and the correlation coefficient obtained for the
validation data set for GRNN and BPNN is more than 91%. However,
it is much faster to train GRNN network than a BPNN and GRNN is
often more accurate than BPNN. GRNN requires more memory space
to store the model, GRNN features fast learning that does not require
an iterative procedure, and highly parallel structure. GRNN networks
are slower than multilayer perceptron networks at classifying new
cases.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: A novel technique has been developed to generate ultra-stable millimeter-wave signal by optical heterodyning of the output from two slave laser (SL) sources injection-locked to the sidebands of a frequency modulated (FM) master laser (ML). Precise thermal tuning of the SL sources is required to lock the particular slave laser frequency to the desired FM sidebands of the ML. The output signals from the injection-locked SL when coherently heterodyned in a fast response photo detector like high electron mobility transistor (HEMT), extremely stable millimeter-wave signal having very narrow line width can be generated. The scheme may also be used to generate ultra-stable sub-millimeter-wave/terahertz signal.