Abstract: Fibrin degradation is an important part in prevention
or treatment of intravascular thrombosis and cardiovascular diseases.
Plasmin like fibrinolytic enzymes has given new hope to patient with
cardiovascular diseases by treating fibrin aggregation related diseases
with traditional plasminogen activator which have many side effects.
Various researches involving wide range of sources for production of
fibrinolytic proteases, from bacteria, fungi, insects and fermented
foods. But few have looked into endophytic fungi as a potential
source. Sixteen (16) endophytic fungi were isolated from Hibiscus sp.
leaves from six different locations in Shah Alam, Selangor. Only two
endophytic fungi, FH3 and S13 showed positive fibrinolytic protease
activities. FH3 produced 5.78cm and S13 produced 4.48cm on Skim
Milk Agar after 4 days of incubation at 27°C. Fibrinolytic activity
was observed; 3.87cm and 1.82cm diameter clear zone on fibrin plate
of FH3 and S13 respectively. 18srRNA was done for identification of
the isolated fungi with positive fibrinolytic protease. S13 had the
highest similarity (100%) to that of Penicillium citrinum strain TG2
and FH3 had the highest similarity (99%) to that of Fusarium sp.
FW2PhC1, Fusarium sp. 13002, Fusarium sp. 08006, Fusarium
equiseti strain Salicorn 8 and Fungal sp. FCASAn-2. Media
composition variation showed the effects of carbon nitrogen on
protein concentration, where the decrement of 50% of media
composition caused drastic decrease in protease of FH3 from 1.081 to
0.056 and also S13 from 2.946 to 0.198.
Abstract: Amyloid aggregation of polypeptides is related to a
growing number of pathologic states known as amyloid disorders. In
recent years, blocking or reversing amyloid aggregation via the use of
small compounds are considered as two useful approaches in
hampering the development of these diseases. In this research, we
have compared the ability of several manganese-salen derivatives, as
synthetic compounds, and apigenin, as a natural flavonoid, to inhibit
of hen egg-white lysozyme (HEWL) aggregation, as an in vitro
model system.
Different spectroscopic analyses such as Thioflavin T (ThT) and
Anilinonaphthalene-8-sulfonic acid (ANS) fluorescence, Congo red
(CR) absorbance along with transmission electron microscopy were
used in this work to monitor the HEWL aggregation kinetic and
inhibition. Our results demonstrated that both type of compounds
were capable to prevent the formation of lysozyme amyloid
aggregation in vitro. In addition, our data indicated that synthetic
compounds had higher activity to inhibit of the β-sheet structures
relative to natural compound. Regarding the higher antioxidant
activities of the salen derivatives, it can be concluded that in addition
to aromatic rings of each of the compounds, the potent antioxidant
properties of salen derivatives contributes to lower lysozyme fibril
accumulation.
Abstract: Advances in the field of image processing envision a
new era of evaluation techniques and application of procedures in
various different fields. One such field being considered is the
biomedical field for prognosis as well as diagnosis of diseases. This
plethora of methods though provides a wide range of options to select
from, it also proves confusion in selecting the apt process and also in
finding which one is more suitable. Our objective is to use a series of
techniques on bone scans, so as to detect the occurrence of
rheumatoid arthritis (RA) as accurately as possible. Amongst other
techniques existing in the field our proposed system tends to be more
effective as it depends on new methodologies that have been proved
to be better and more consistent than others. Computer aided
diagnosis will provide more accurate and infallible rate of
consistency that will help to improve the efficiency of the system.
The image first undergoes histogram smoothing and specification,
morphing operation, boundary detection by edge following algorithm
and finally image subtraction to determine the presence of
rheumatoid arthritis in a more efficient and effective way. Using preprocessing
noises are removed from images and using segmentation,
region of interest is found and Histogram smoothing is applied for a
specific portion of the images. Gray level co-occurrence matrix
(GLCM) features like Mean, Median, Energy, Correlation, Bone
Mineral Density (BMD) and etc. After finding all the features it
stores in the database. This dataset is trained with inflamed and noninflamed
values and with the help of neural network all the new
images are checked properly for their status and Rough set is
implemented for further reduction.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.
Abstract: Free radicals are atoms or molecules with unpaired electrons. Many diseases are caused by free radicals. Normally, free radical formation is controlled naturally by various beneficial compounds known as antioxidants. Several analytical methods have been used for qualitative and quantitative determination of antioxidants, and each has its own specificity. This project aimed to evaluate antioxidant activity of ethanolic and aqueous extracts from the rice paddy herb (Limnophila aromatica (Lam.) Merr.) measured by DPPH and Hydroxyl radical scavenging method. The results showed that averaged antioxidant activity measured in ethanolic extract (µmol Ascorbic acid equivalent/g fresh mass) were 67.09± 4.99 and 15.55±4.82 as determined by DPPH and Hydroxyl radical scavenging activity assays, respectively. Averaged antioxidant activity measured in aqueous extract (µmol Ascorbic acid equivalent/g fresh mass) were 21.08±1.25 and 10.14±3.94 as determined by DPPH and Hydroxyl radical scavenging activity assays respectively.
Abstract: Cancer is a widespread disease in the world and is the third reason of deaths among the chronic diseases. Educating patients and caregivers has a vital role for empowering them in managing disease and treatment's symptoms. Informing of the patients about their disease and treatment process decreases patient's distress and decisional conflicts, improves wellbeing of them, increase success of the treatment and survival. In this era, technological education methods are used for patients that have different chronic disease. Many studies indicated that especially web based patient education such as chronic obstructive lung disease; heart failure is more effective than printed materials. Web based education provide easiness to patients while they are reaching health services. It also has more advantages because of it decreases health cost and requirement of staff. It is thought that web based education may be beneficial method for cancer patient's empowerment in coping with the disease's symptoms. The aim of the study is evaluate the effectiveness of web based education for cancer patients' clinical outcomes.
Abstract: Seventy-nine accessions, including two local wild species (Chenopodium album and C. murale) and several cultivated quinoa lines developed through recurrent selection in Morocco were screened for their resistance against Peronospora farinose, the causal agent of downy mildew disease. The method of artificial inoculation on detached healthy leaves taken from the middle stage of the plant was used. Screened accessions showed different levels of quantitative resistance to downy mildew as they were scored through the calculation of their area under disease progress curve and their two resistance components, the incubation period and the latent period. Significant differences were found between accessions regarding the three criteria (Incubation Period, Latent Period and Area Under Diseases Progress Curve). Accessions M2a and S938/1 were ranked resistant as they showed the longest Incubation Period (7 days) and Latent Period (12 days) and the lowest area under diseases progress curve (4). Therefore, M24 is the most susceptible accession as it has presented the highest area under diseases progress curve (34.5) and the shortest Incubation Period (1 day) and Latent Period (3 days). In parallel to this evaluation approach, the accession resistance was confirmed under the field conditions through natural infection by using the tree-leaf method. The high correlation found between detached leaf inoculation method and field screening under natural infection allows us to use this laboratory technique with sureness in further selection works.
Abstract: This paper proposes and analyzes an SIRS epidemic model incorporating the effects of the awareness programs driven by the media. Media and media driven awareness programs play a promising role in disseminating the information about outbreak of any disease across the globe. This motivates people to take precautionary measures and guides the infected individuals to get hospitalized. Timely hospitalization helps to reduce diagnostic delays and hence results in fast recovery of infected individuals. The aim of this study is to investigate the impact of the media on the spread and control of infectious diseases. This model is analyzed using stability theory of differential equations. The sensitivity of parameters has been discussed and it has been found that the awareness programs driven by the media have positive impact in reducing the infection prevalence of the infective population in the region under consideration.
Abstract: This paper presents methods for formal modeling of activities in the area of sanitary inspectors outbreak of food-borne diseases. The models allow you to measure the characteristics of the activities of sanitary inspection and as a result allow improving the performance of sanitary services and thus food security.
Abstract: Alongside with antioxidant, pro-oxidant activity is also observed in phytochemical compounds. In the study, Ficus odorata, an endemic medicinal plant in the Philippines, was screened for the potential medical application of its pro-oxidant activity.
Phytochemical screening revealed the presence of terpenes, glycosides and phenolic acids. The crude extract was found to contain low gallic acid and quercetin equivalence. The TLC chromatogram of the crude extract showed that none of the 11 spots obtained has antioxidant activity nor correspond to gallic acid and quercetin standards. Experiments showed that the crude extract has stimulatory activity towards DPPH radicals, hydrogen peroxide, hydroxyl radicals, superoxide anions and nitric oxide. Moreover, the extract exhibited a low ferric reducing power.
The prooxidant activity was evident in the crude ethanolic leaf extract of F. odorata, which may provide a better understanding of the plant’s pharmacological importance in the prevention of diseases.
Abstract: Nonstationary and nonlinear signals generated by living complex systems defy traditional mechanistic approaches, which are based on homeostasis. Previous our studies have shown that the evaluation of the interactions of physiological signals by using special analysis methods is suitable for observation of physiological processes. It is demonstrated the possibility of using deep physiological model, based on the interpretation of the changes of the human body’s functional states combined with an application of the analytical method based on matrix theory for the physiological signals analysis, which was applied on high risk cardiac patients. It is shown that evaluation of cardiac signals interactions show peculiar for each individual functional changes at the onset of hemodynamic restoration procedure. Therefore, we suggest that the alterations of functional state of the body, after patients overcome surgery can be complemented by the data received from the suggested approach of the evaluation of functional variables’ interactions.
Abstract: Humans use plants for thousands of years to treat various ailments, in many developing countries; much of the population relies on traditional doctors and their collections of medicinal plants to cure them.
Essential oils have many therapeutic properties. In herbal medicine, they are used for their antiseptic properties against infectious diseases of fungal origin, against dermatophytes, those of bacterial origin.
The aim of our study is to determine the antimicrobial effect of essential oils of the plant Schinus molle on some pathogenic bacteria. It is a medicinal plant used in traditional therapy. Essential oils have many therapeutic properties. In herbal medicine, they are used for their antiseptic properties against infectious diseases of fungal origin, against dermatophytes, those of bacterial origin.
The test adopted, is based on the diffusion method on solid medium (Antibiogram), this method allows to determine the susceptibility or resistance of an organism according to the sample studied.
Our study reveals that the essential oil of the plant Schinus molle has a different effect on the resistance of germs: for Pseudomonas aeruginosa strain is a moderately sensitive with an inhibition zone of 10mm, further Enterobacter, Escherichia coli and Proteus are strains that represent a high sensitivity, a zone of inhibition equal to 14.66 mm.
Abstract: Many inherited diseases and non-hereditary disorders are common in the development of renal cystic diseases. Polycystic kidney disease (PKD) is a disorder developed within the kidneys in which grouping of cysts filled with water like fluid. PKD is responsible for 5-10% of end-stage renal failure treated by dialysis or transplantation. New experimental models, application of molecular biology techniques have provided new insights into the pathogenesis of PKD. Researchers are showing keen interest for developing an automated system by applying computer aided techniques for the diagnosis of diseases. In this paper a multilayered feed forward neural network with one hidden layer is constructed, trained and tested by applying back propagation learning rule for the diagnosis of PKD based on physical symptoms and test results of urinalysis collected from the individual patients. The data collected from 50 patients are used to train and test the network. Among these samples, 75% of the data used for training and remaining 25% of the data are used for testing purpose. Further, this trained network is used to implement for new samples. The output results in normality and abnormality of the patient.
Abstract: The study aimed at determining the impact of chronic hepatitis C virus (HCV) infection on patients’ Quality of Life (QoL), its relation to geographical characteristics of patients, awareness of the disease, treatment regimen, co-morbid psychiatric or other diseases. 457 patients were randomly selected from ten National Treatment Reference Centers of Ministry of Health hospitals from four community locations representing Egypt. Health related QoL assessment questionnaire with the 36-item Short Form used for assessment of the enrolled patients. The study showed no significant difference between HCV patients in different governorates as regards total QoL. Females, illiterate patients and those had bilharziasis, diabetes mellitus, hypertension or were depressed had significantly the lowest QoL score. HCV patients who knew the danger of the disease had significant lower mean score of physical and mental health components. Optimal care of overall well-being of HCV patients requires adequate knowledge of their neurological and psychological status. It is important to know how to cope with having a family member with hepatitis C and more importantly to know what should you say and what shouldn’t you say as a positive hopeful attitude is essential for combating HCV chronic infection.
Abstract: Modelling is a widely used tool to facilitate the evaluation of disease management. The interest of epidemiological models lies in their ability to explore hypothetical scenarios and provide decision makers with evidence to anticipate the consequences of disease incursion and impact of intervention strategies.
All models are, by nature, simplification of more complex systems. Models that involve diseases can be classified into different categories depending on how they treat the variability, time, space, and structure of the population. Approaches may be different from simple deterministic mathematical models, to complex stochastic simulations spatially explicit.
Thus, epidemiological modelling is now a necessity for epidemiological investigations, surveillance, testing hypotheses and generating follow-up activities necessary to perform complete and appropriate analysis.
The state of the art presented in the following, allows us to position itself to the most appropriate approaches in the epidemiological study.
Abstract: There is long history of konjac tubers being used as a cure for certain diseases in China and Japan. Konjac flour is prepared from konjac tubers and it contains high concentration of glucomannan. Konjac Glucomannan (KGM) is dietary fiber and the role of which has been demonstrated in weight reduction, lowering blood cholesterol and sugar level, promoting intestinal activity etc. Konjac glucomanan has a property of swelling by absorbing water, more than a hundred times its own weight. Therefore it helps increasing weight of feces, water content of feces, and promotes satiety feeling. Mode of actions of dietary fibre as laxatives agents includes holding water inside the bowel lumen, inhibition of water absorption in the colon and stimulating colonic motility. Number of fecal pellets did not effected in rats were fed on 300 and 600 mg/kg of konjac flour, as well as constipated control and Dulcolax treatment. Water content, weight of fecal pellets and gastrointestinal transit ratio were higher in rats treated with 600 mg/kg than 300 mg/kg of konjac flour. Rats were administered with Dulcolax showed the highest gastrointestinal transit ratio, followed by 600 mg/kg konjac flour. The lowest feed consumption was noted in 600 mg/kg konjac flour diet group.