Abstract: The aim of this study was to determine the antimicrobial effect of Helichrysum arenarium L. essential oil in "in-vitro" condition on the growth of seven microbial species including Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Saccharomyces cereviciae, Candida albicans, Aspergillus flavus and Aspergillus parasiticus using micro-dilution method. The minimum inhibitory concentration (MIC) and minimum bactericidal or fungicidal concentration (MBC, MFC) were determined for the essential oil at ten concentrations. Finally, the sensitivity of tested microbes to essential oil of H. arenarium was investigated. Results showed that Bacillus subtilis (MIC=781.25 and MBC=6250 µg/ml) was more resistance than two other bacterial species. Among the tested yeasts, Saccharomyces cereviciae (MIC=97.65 and MFC=781.25 µg/ml) was more sensitive than Candida albicans while among the fungal species, growth of Aspergillus parasiticus inhibited at lower concentration of oil than the Aspergillus flavus. The extracted essential oil exhibited the same MIC value in the liquid medium against all fungal strains (48.82 µg/ml), while different activity against A. flavus and A. parasiticus was observed in this medium with MFC values of 6250 and 390.625µg/ml, respectively. The results of the present study indicated that Helichrysum arenarium L essential oil had significant (P
Abstract: In this paper we introduce a bacteria-leukocyte model
with bacteria chemotaxsis. We assume that bacteria develop a tactic
defence mechanism as a response to Leukocyte phagocytosis. We
explore the effect of this tactic motion on Turing space in two
parameter spaces. A fine tuning of bacterial chemotaxis shows a
significant effect on developing a non-uniform steady state.
Abstract: The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: Castor (Ricinus communis L.) is one of the important
non-edible oilseed crops having immense industrial and medicinal
value. Oil yield per unit area is the ultimate target in growing oilseed
plants and sowing date is one of the important factors which have a
clear role on production of active substances particularly in oilseeds.
This study was conducted to evaluate the effect of sowing date on the
seed and oil yield of castor in Central Anatolia of Turkey in 2011.
The field experiment was set up in a completely randomized block
design with three replications. Black Diamond-2 castor cultivar was
used as plant material. The treatment was four sowing dates of May
10, May 25, June 10, June 25. In this research; seed yield, oil content
and oil yield were investigated. Results showed that the effect of
different sowing dates were significant on all of characteristics. In
general; delayed sowing dates, resulted in decreased seed yield, oil
content and oil yield. The highest value of seed yield, oil content and
oil yield (respectively, 2523.7 kg ha-1, 51.18% and 1292.2 kg ha-1)
were obtained from the first sowing date (May 10) while the lowest
seed yield, oil content and oil yield (respectively, 1550 kg ha-1,
43.67%, 677.3 kg ha-1) were recorded from the latest sowing date
(June 25). Therefore, it can be concluded that early May could be
recommended as an appropriate sowing date in the studied location
and similar climates for achieved high oil yield of castor.
Abstract: The acidity (citric acid) is the one of chemical content that can be refer to the internal quality and it’s a maturity index of tomato, The titratable acidity (%TA) can be predicted by a non-destructive method prediction by using the transmittance short wavelength (SW-NIR) spectroscopy in the wavelength range between 665-955 nm. The set of 167 tomato samples divided into groups of 117 tomatoes sample for training set and 50 tomatoes sample for test set were used to establish the calibration model to predict and measure %TA by partial least squares regression (PLSR) technique. The spectra were pretreated with MSC pretreatment and it gave the optimal result for calibration model as (R = 0.92, RMSEC = 0.03%) and this model obtained high accuracy result to use for %TA prediction in test set as (R = 0.81, RMSEP = 0.05%). From the result of prediction in test set shown that the transmittance SW-NIR spectroscopy technique can be used for a non-destructive method for %TA prediction of tomato.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Banana pseudo-stem and fruit-bunch-stem are
agricultural residues that can be used for conversion to bio-char, biooil,
and gases by using thermochemical process. The aim of this work
is to characterize banana pseudo-stem and banana fruit-bunch-stem
through proximate analysis, elemental analysis, chemical analysis,
thermo-gravimetric analysis, and heating calorific value. The ash
contents of the banana pseudo-stem and banana fruit-bunch-stem are
11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana
pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf
wt.% respectively. The molecular formulas for banana stem and
banana fruit-bunch-stem are C24H33NO26 and C19H29NO33
respectively. The measured higher heating values of banana pseudostem
and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg
respectively. By chemical analysis, the lignin, cellulose, and
hemicellulose contents in the samples will also be presented. The
feasibility of the banana wastes to be a feedstock for thermochemical
process in comparison with other biomass will be discussed in this
paper.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: This paper presents the effect of electric field
distribution which is an electric field intensity analysis. Consideration
of the dielectric heating of grains and insects, the rice and rice
weevils are utilized for dielectric heating analysis. Furthermore, this
analysis compares the effect of electric field distribution in rice and
rice weevil. In this simulation, two copper plates are used to generate
the electric field for dielectric heating system and put the rice
materials between the copper plates. The simulation is classified in
two cases, which are case I one rice weevil is placed in the rice and
case II two rice weevils are placed at different position in the rice.
Moreover, the probes are located in various different positions on
plate. The power feeding on this plate is optimized by using CST EM
studio program of 1000 watt electrical power at 39 MHz resonance
frequency. The results of two cases are indicated that the most
electric field distribution and intensity are occurred on the rice and
rice weevils at the near point of the probes. Moreover, the heat is
directed to the rice weevils more than the rice. When the temperature
of rice and rice weevils are calculated and compared, the rice weevils
has the temperature more than rice is about 41.62 Celsius degrees.
These results can be applied for the dielectric heating applications to
eliminate insect.
Abstract: The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.
Abstract: The objective of this study was to investigate the lifelong
effect of in utero nutrition fed at different stages of pregnancy in
Bali cows (n = 40): (U1) without in utero nutrition (0 – parturition,
negative control); (U2) 0 – 90 d of gestation; (U3) 90 - 180 d of
gestation; (U4) 180 d – parturition; and (U5) in utero nutrition along
gestation period (0 d to parturition – positive control) on the growth
performance of the offspring to weaning age. The results indicated
that effect of maternal nutrition on male and female offspring were
particularly indicated by the growth performance of both the male
and female offspring from birth to weaning.
Abstract: The study aimed to collect morphological data of
secretory structures that contribute to taxonomy of Indigofera. Detail
features of trichomes occurrence in vegetative and reproductive
organs of Indigofera wightii Grah. ex Wigh & Arn., a species
traditionally used as source of indigo to dye “Thaisongdam” clothing
were investigated. Examination through light microscopy and
scanning electrom microscopy were done. Non secretory, T-shaped
trichomes appeared throughout surfaces of stems, leaves, flowers and
fruits. Secretory or glandular trichomes occurred in two types; one
has big cylindrical head and short peduncle, distributed on adaxial
surface of sepals and around the pedicel, whereas another possesses
smaller cylindrical head but long peduncle. The latter was found on
apical surface of immature pods. No phenolic and lipophilic
compounds were detected from these glands.
Abstract: This study was aimed to investigate the effect of
various organic supplements on growth and development of
Dendrobium discolor’s protocorms and seedlings growth of
Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0
cm. in diameter and seedlings of Dendrobium Judy Rutz at the same
size (0.5 cm. height) were sub-cultured on Hyponex medium
supplemented with cow milk (CM), soy milk (SM), potato extract
(PE) and peptone (P) for 2 months. The protocorms were developed
to seedlings in all treatments after cultured for 2 months. However,
the best results were found on Hyponex medium supplemented with
P was the best in which the maximum fresh and dry weight and
maximum shoot height were obtained in this treatment statistically
different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium
supplemented with P also stimulated the maximum mean number of
5.7 shoots per explant which also showed statistically different (p ≤
0.05) when compared to other treatments. The results of growth of
Dendrobium Judy Rutz seedlings indicated the medium
supplemented with 100 mL/L PE enhanced the maximum fresh and
dry weigh per explants with significantly different (p ≤ 0.05) in fresh
weight from other treatments including the control medium without
any organic supplementation. However, the dry weight was not
significantly different (p ≤ 0.05) from medium supplemented with
SM and P. There was multiple shoots induction in all media with or
without organic supplementation ranging from 2.6 to 3 shoots per
explants. The maximum shoot height was also obtained in the
seedlings cultured on medium supplemented with PE while the
longest root length was found in medium supplemented with SM.
Abstract: This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements.