Abstract: The global demand for long-tailed macaques for
medical experimentation has continued to increase. Fulfillment of
Indonesian export demands has been mostly from natural habitats,
based on a harvesting quota. This quota has been determined
according to the total catch for a given year, and not based on
consideration of any demographic parameters or physical
environmental factors with regard to the animal; hence threatening
the sustainability of the various populations. It is therefore necessary
to formulate a method for calculating a sustainable harvesting quota,
based on population parameters in natural habitats. Considering the
possibility of variations in habitat characteristics and population
parameters, a time series observation of demographic and
physical/biotic parameters, in various habitats, was performed on 13
groups of long-tailed macaques, distributed throughout the West
Java, Lampung and Yogyakarta areas of Indonesia. These provinces
were selected for comparison of the influence of human/tourism
activities. Data on population parameters that was collected included
data on life expectancy according to age class, numbers of
individuals by sex and age class, and ‘ratio of infants to reproductive
females’. The estimation of population growth was based on a
population dynamic growth model: the Leslie matrix. The harvesting
quota was calculated as being the difference between the actual
population size and the MVP (minimum viable population) for each
sex and age class. Observation indicated that there were variations within group size
(24–106 individuals), gender (sex) ratio (1:1 to 1:1.3), life expectancy
value (0.30 to 0.93), and ‘ratio of infants to reproductive females’
(0.23 to 1.56). Results of subsequent calculations showed that
sustainable harvesting quotas for each studied group of long-tailed
macaques, ranged from 29 to 110 individuals. An estimation model
of the MVP for each age class was formulated as Log Y = 0.315 +
0.884 Log Ni (number of individual on ith age class). This study also
found that life expectancy for the juvenile age class was affected by
the humidity under tree stands, and dietary plants’ density at sapling,
pole and tree stages (equation: Y=2.296 – 1.535 RH + 0.002 Kpcg –
0.002 Ktg – 0.001 Kphn, R2 = 89.6% with a significance value of
0.001). By contrast, for the sub-adult-adult age class, life expectancy
was significantly affected by slope (equation: Y=0.377 = 0.012 Kml,
R2 = 50.4%, with significance level of 0.007). The infant-toreproductive-
female ratio was affected by humidity under tree stands,
and dietary plant density at sapling and pole stages (equation: Y = -
1.432 + 2.172 RH – 0.004 Kpcg + 0.003 Ktg, R2 = 82.0% with
significance level of 0.001). This research confirmed the importance
of population parameters in determining the minimum viable
population, and that MVP varied according to habitat characteristics
(especially food availability). It would be difficult therefore, to
formulate a general mathematical equation model for determining a
harvesting quota for the species as a whole.
Abstract: The purpose of this study is the discrimination of 28
postmenopausal with osteoporotic femoral fractures from an agematched
control group of 28 women using texture analysis based on
fractals. Two pre-processing approaches are applied on radiographic
images; these techniques are compared to highlight the choice of the
pre-processing method. Furthermore, the values of the fractal
dimension are compared to those of the fractal signature in terms of
the classification of the two populations. In a second analysis, the
BMD measure at proximal femur was compared to the fractal
analysis, the latter, which is a non-invasive technique, allowed a
better discrimination; the results confirm that the fractal analysis of
texture on calcaneus radiographs is able to discriminate osteoporotic
patients with femoral fracture from controls. This discrimination was
efficient compared to that obtained by BMD alone. It was also
present in comparing subgroups with overlapping values of BMD.
Abstract: In the years followed independence, an economic
crisis and some conflicts led to the displacement of many people
inside Georgia. The growing poverty, unemployment, low income
and its unequal distribution limited access to basic social service have
had a clear direct impact on Georgian population dynamics and its
age-sex structure. Factors influencing the changing population age
structure and urbanization include mortality, fertility, migration and
expansion of urban. In this paper presents the main factors of
changing the distribution by urban and rural areas. How different are
the urban and rural age and sex structures? Does Georgia have the
same age-sex structure among their urban and rural populations since
1950s?
Abstract: Paranoid ideation is a common thought process that
constitutes a defense against perceived social threats. The current
study aimed at the characterization of paranoid ideation in youths and
to explore the possible predictors involved in the development of
paranoid ideations. Paranoid ideation, shame, submission, early
childhood memories and current depressive, anxious and stress
symptomatology were assessed in a sample of 1516 Portuguese
youths. Higher frequencies of paranoid ideation were observed,
particularly in females and youths from lower socioeconomic status.
The main predictors identified relates to submissive behaviors and
adverse childhood experiences, and especially to shame feelings. The
current study emphasizes that the these predictors are similar to
findings in adults and clinical populations, and future implications to
research and clinical practice aiming at paranoid ideations are
discussed, as well as the pertinence of the study of mediating factors
that allow a wider understanding of this thought process in younger
populations and the prevention of psychopathology in adulthood.
Abstract: The aim of the current study was to develop and
validate a Response to Stressful Situations Scale (RSSS) for the
Portuguese population. This scale assesses the degree of stress
experienced in scenarios that can constitute positive, negative and
more neutral stressors, and also describes the physiological,
emotional and behavioral reactions to those events according to their
intensity. These scenarios include typical stressor scenarios relevant
to patients with schizophrenia, which are currently absent from most
scales, assessing specific risks that these stressors may bring on
subjects, which may prove useful in non-clinical and clinical
populations (i.e. Patients with mood or anxiety disorders,
schizophrenia). Results from Principal Components Analysis and
Confirmatory Factor Analysis of two adult samples from general
population allowed to confirm a three-factor model with good fit
indices: χ2 (144)= 370.211, p = 0.000; GFI = 0.928; CFI = 0.927; TLI =
0.914, RMSEA = 0.055, P(rmsea ≤0.005) = .096; PCFI = .781.
Further data analysis of the scale revealed that RSSS is an adequate
assessment tool of stress response in adults to be used in further
research and clinical settings, with good psychometric characteristics,
adequate divergent and convergent validity, good temporal stability
and high internal consistency.
Abstract: In this paper, we used data mining to extract
biomedical knowledge. In general, complex biomedical data
collected in studies of populations are treated by statistical methods,
although they are robust, they are not sufficient in themselves to
harness the potential wealth of data. For that you used in step two
learning algorithms: the Decision Trees and Support Vector Machine
(SVM). These supervised classification methods are used to make the
diagnosis of thyroid disease. In this context, we propose to promote
the study and use of symbolic data mining techniques.
Abstract: Although there had been a many studies that shows
the impact of air pollution on physical health, comparatively less was
known of human behavioral responses and annoyance impacts.
Annoyance caused by air pollution is a public health problem because
it can be an ambient stressor causing stress and disease and can affect
quality of life. The objective of this work is to evaluate the
annoyance caused by air pollution in two different industrialized
urban areas, Dunkirk (France) and Vitoria (Brazil). The populations
of these cities often report feeling annoyed by dust. Surveys were
conducted, and the collected data were analyzed using statistical
analyses. The results show that sociodemographic variables,
importance of air quality, perceived industrial risk, perceived air
pollution and occurrence of health problems play important roles in
the perceived annoyance. These results show the existence of a
common problem in geographically distant areas and allow
stakeholders to develop prevention strategies.
Abstract: It is likely that robots will cross the boundaries of
industry into households over the next decades. With demographic
challenges worldwide, the future ageing populations will require the
introduction of assistive technologies capable of providing, care,
human dignity and quality of life through the aging process. Robotics
technology has a high potential for being used in the areas of social
and healthcare by promoting a wide range of activities such as
entertainment, companionship, supervision or cognitive and physical
assistance. However such close Human Robotics Interaction (HRI)
encompass a rich set of ethical scenarios that need to be addressed
before Socially Assistive Robots (SARs) reach the global markets.
Such interactions with robots may seem a worthy goal for many
technical/financial reasons but inevitably require close attention to
the ethical dimensions of such interactions. This article investigates
the current HRI benchmark of social success. It revises it according
to the ethical principles of beneficence, non-maleficence and justice
aligned with social care ethos. An extension of such benchmark is
proposed based on an empirical study of HRIs conducted with elderly
groups.
Abstract: The objective of this study was to assess whether
living in proximity to a roofing fiber cement factory in southern
Thailand was associated with physical, mental, social, and spiritual
health domains measured in a self-reported health risk assessment
(HRA) questionnaire. A cross-sectional study was conducted among
community members divided into two groups: near population (living
within 0-2km of factory) and far population (living within 2-5km of
factory) (N=198). A greater proportion of those living far from the
factory (65.34%) reported physical health problems than the near
group (51.04%) (p =0.032). This study has demonstrated that the near
population group had higher proportion of participants with positive
ratings on mental assessment (30.34%) and social health impacts
(28.42%) than far population group (10.59% and 16.67%,
respectively) (p
Abstract: The Roma (Gypsies) is a transnational minority with a
high degree of consanguineous marriages. Similar to other
genetically isolated founder populations, the Roma harbor a number
of unique or rare genetic disorders. This paper discusses about a rare
form of Charcot-Marie-Tooth disease – type 4G (CMT4G), also
called Hereditary Motor and Sensory Neuropathy type Russe, an
autosomal recessive disease caused by mutation private to Roma
characterized by abnormally increased density of non-myelinated
axons. CMT4G was originally found in Bulgarian Roma and in 2009
two putative causative mutations in the HK1 gene were identified.
Since then, several cases were reported in Roma families mainly
from Bulgaria and Spain. Here we present a Slovak Roma family in
which CMT4G was diagnosed on the basis of clinical examination
and genetic testing. This case is a further proof of the role of the HK1
gene in pathogenesis of the disease. It confirms that mutation in the
HK1 gene is a common cause of autosomal recessive CMT disease in
Roma and should be considered as a common part of a diagnostic
procedure.
Abstract: Taro Scarab beetles (Papuana uninodis, Coleoptera:
Scarabaeidae) inflict severe damage on important root crops and
plants such as Taro or Cocoyam, yam, sweet potatoes, oil palm and
coffee tea plants across Africa and Asia resulting in economic
hardship and starvation in some nations. Scoliid wasps and
Metarhizium anisopliae fungus - bio-control agents; are shown to be
able to control the population of Scarab beetle adults and larvae using
a newly created simulation model based on non-linear ordinary
differential equations that track the populations of the beetle life
cycle stages: egg, larva, pupa, adult and the population of the scoliid
parasitoid wasps, which attack beetle larvae. In spite of the challenge
driven by the longevity of the scarab beetles, the combined effect of
the larval wasps and the fungal bio-control agent is able to control
and drive down the population of both the adult and the beetle eggs
below the environmental carrying capacity within an interval of 120
days, offering the long term prospect of a stable and eco-friendly
environment; where the population of scarab beetles is: regulated by
parasitoid wasps and beneficial soil saprophytes.
Abstract: A study was conducted to determine the diversity and
abundance of shorebird species habituating the mudflat area of Jeram
Beach and Remis Beach, Selangor, Peninsular Malaysia. Direct
observation technique (using binoculars and video camera) was
applied to record the presence of bird species in the sampling sites
from August 2013 until July 2014. A total of 32 species of shorebird
were recorded during both migratory and non-migratory seasons. Of
these, eleven species (48%) are migrants, six species (26%) have both
migrant and resident populations, four species (17%) are vagrants and
two species (9%) are residents. The compositions of the birds
differed significantly in all months (χ2 = 84.35, p < 0.001). There is a
significant difference in avian abundance between migratory and
non-migratory seasons (Mann-Whitney, t = 2.39, p = 0.036). The
avian abundance were differed significantly in Jeram and Remis
Beaches during migratory periods (t = 4.39, p = 0.001) but not during
non-migratory periods (t = 0.78, p = 0.456). Shorebird diversity was
also affected by tidal cycle. There is a significance difference
between high tide and low tide (Mann-Whitney, t = 78.0, p < 0.005).
Frequency of disturbance also affected the shorebird distribution
(Mann-Whitney, t = 57.0, p = 0.0134). Therefore, this study
concluded that tides and disturbances are two factors that affecting
temporal distribution of shorebird in mudflats area.
Abstract: Multipotent mesenchymal stromal cells (MSCs)
possess immunomodulatory properties. The effect of MSCs on the
crucial cellular immunity compartment – T-cells is of a special
interest. It is known that MSC tissue niche and expected milieu of
their interaction with T- cells are characterized by low oxygen
concentration, whereas the in vitro experiments usually are carried
out at a much higher ambient oxygen (20%). We firstly evaluated
immunomodulatory effects of MSCs on T-cells at tissue-related
oxygen (5%) after interaction implied cell-to-cell contacts and
paracrine factors only. It turned out that MSCs under reduced oxygen
can effectively suppress the activation and proliferation of PHAstimulated
T-cells and can provoke decrease in the production of
proinflammatory and increase in anti-inflammatory cytokines. In
hypoxia some effects were amplified (inhibition of proliferation, antiinflammatory
cytokine profile shift). This impact was more evident
after direct cell-to-cell interaction; lack of intercellular contacts could
revoke the potentiating effect of hypoxia.
Abstract: This study has only one objective which is to identify the different in factors of choosing the distributor for food and non-food OTOP entrepreneur in Thailand. In this research, the types of OTOP product will be divided into two groups which are food and non-food. The sample for the food type OTOP product was the processed fruit and vegetable from Nakorn Pathom province and the sample for the non-food type OTOP product was the court doll from Ang Thong province. The research was divided into 3 parts which were a study of the distribution pattern and how to choose the distributor of the food type OTOP product, a study of the distribution pattern and how to choose the distributor of the non-food type OTOP product and a comparison between 2 types of products to find the differentiation in the factor of choosing distributor. The data and information was collected by using the interview. The populations in the research were 5 producers of the processed fruit and vegetable from Nakorn Pathom province and 5 producers of the court doll from Ang Thong province. The significant factor in choosing the distributor of the food type OTOP product is the material handling efficiency and on-time delivery but for the non-food type OTOP product is focused on the channel of distribution and cost of the distributor.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: The differences on proximate composition, sensorial analysis (for raw and cooked samples) and flesh productivity of the samples of Parapenaus longirostris that were caught in the North Aegean Sea and Marmara Sea were investigated. Moisture, protein, lipid, ash, carbohydrate, energy content of the North Aegean Sea shrimp were found 74.92 ± 0.1, 20.32 ± 0.16, 2.55 ± 0.1, 2.13 ± 0.08, 0.08%, 110.1 kcal/100 g, respectively. On the other hand, the Marmara Sea shrimp was found 76.9 ± 0.02, 19.06 ± 0.03, 2.22 ± 0.08, 1.51 ± 0.04, 0.33, 102.77 kcal/100g, respectively. Protein, lipid, ash and energy values of the Northern Aegean Sea shrimp were higher than the Marmara Sea shrimp. On the other hand, moisture, carbohydrate values of the Northern Aegean Sea shrimp were lower than the Marmara samples. Sensorial analyses were carried on for raw and cooked samples. Among all properties for raw samples, flesh color, shrimp connective tissue, shrimp body parameters were different from each other according to the result of the panel. According to the result of the cooked shrimp samples among all properties, cooked odour, flavor and texture were different from each other as well. Especially, flavor and textural properties of cooked shrimps of the Northern Aegean Sea were higher than the Marmara Sea shrimp. The flesh yield of the Northern Aegean Sea shrimp was found 46.42%, while Marmara Sea shrimp was found 47.74%.
Abstract: Australia does not have varroa mite. However, we investigated the efficacy of modified hive bottom boards used for varroa mite management in honeybee colonies to control small hive beetle, Aethina tumida. We assessed infestation levels between hives fitted with tube, mesh and conventional (solid) bottom boards in Richmond, NSW eastern Australian. Colonies housed in hives with tube bottom boards were significantly superior to those in hives with conventional and mesh bottom boards. Even though in-hive beetle populations were generally low during the trial period, hives fitted with tube bottom boards however, had fewer small hive beetles than other hives. Although the trial was conducted over only one season, it suggests that there may be benefit in Australian beekeepers changing from using conventional bottom boards even with the absence of varroa mite, when small hive beetle is present.
Abstract: The aging of the workforce is occurring globally and has significant impact on organizations. The Malaysian population is ageing. Although, not as quickly as the populations of a number of Asian nations, or of parts of Europe; the rate is sufficient to cause a concern. The life expectancy of Malaysians has increased in year 2012 with an average of 73.8 years or equal to 71.1 years for males and 76.7 years for females. The birth and death rates are 26.05 births/1,000 population and 5.29 deaths/1,000 population respectively. These figures have placed a greater liability on the government’s shoulder, and have become a push factor for the country to revise a new retirement age for the public servants. The ‘aged population’ impinged on the new challenges faced by the Malaysian government, which had to deal with an unproductive aged workforce. A new retirement age from 58 to 60 years old has been introduced and this could have a positive effect on this cohort, in maintaining financial security. However, keeping older employees might affect organizations’ performance and productivity. The organizations need to pay more attention on them, since they are less effective and might be affected by numerous health problems. An innovative culture should be introduced and this could be a good indicator for organizations that deal with these ‘expensive’ workers.