Abstract: The hydrogenated amorphous carbon films (α-C:H)
were deposited on p-type Si (100) substrates at different thicknesses by
radio frequency plasma enhanced chemical vapor deposition
technique (rf-PECVD). Raman spectra display asymmetric
diamond-like carbon (DLC) peaks, representative of the α-C:H films.
The decrease of intensity ID/IG ratios revealed the sp3 content arise at
different thicknesses of the α-C:H films. In terms of mechanical
properties, the high hardness and elastic modulus values showed the
elastic and plastic deformation behaviors related to sp3 content in
amorphous carbon films. Electrochemical properties showed that the
α-C:H films exhibited excellent corrosion resistance in air-saturated
3.5 wt.% NaCl solution for pH 2 at room temperature. Thickness
increasing affected the small sp2 clusters in matrix, restricting the
velocity transfer and exchange of electrons. The deposited α-C:H films
exhibited excellent mechanical properties and corrosion resistance.
Abstract: At-site flood frequency analysis is used to estimate
flood quantiles when at-site record length is reasonably long. In
Australia, FLIKE software has been introduced for at-site flood
frequency analysis. The advantage of FLIKE is that, for a given
application, the user can compare a number of most commonly
adopted probability distributions and parameter estimation methods
relatively quickly using a windows interface. The new version of
FLIKE has been incorporated with the multiple Grubbs and Beck test
which can identify multiple numbers of potentially influential low
flows. This paper presents a case study considering six catchments in
eastern Australia which compares two outlier identification tests
(original Grubbs and Beck test and multiple Grubbs and Beck test)
and two commonly applied probability distributions (Generalized
Extreme Value (GEV) and Log Pearson type 3 (LP3)) using FLIKE
software. It has been found that the multiple Grubbs and Beck test
when used with LP3 distribution provides more accurate flood
quantile estimates than when LP3 distribution is used with the
original Grubbs and Beck test. Between these two methods, the
differences in flood quantile estimates have been found to be up to
61% for the six study catchments. It has also been found that GEV
distribution (with L moments) and LP3 distribution with the multiple
Grubbs and Beck test provide quite similar results in most of the
cases; however, a difference up to 38% has been noted for flood
quantiles for annual exceedance probability (AEP) of 1 in 100 for one
catchment. This finding needs to be confirmed with a greater number
of stations across other Australian states.
Abstract: Hydrogenated amorphous carbon (a-C:H) films have
been synthesized by a radio frequency plasma enhanced chemical
vapor deposition (rf-PECVD) technique with different bias voltage
from 0.0 to -0.5 kV. The Raman spectra displayed the polymer-like
hydrogenated amorphous carbon (PLCH) film with 0.0 to -0.1 and
a-C:H films with -0.2 to -0.5 kV of bias voltages. The surface chemical
information of all films were studied by X-ray photoelectron
spectroscopy (XPS) technique, presented to C-C (sp2 and sp3) and C-O
bonds, and relative carbon (C) and oxygen (O) atomics contents. The
O contamination had affected on structure and optical properties. The
true density of PLCH and a-C:H films were characterized by X-ray
refractivity (XRR) method, showed the result as in the range of
1.16-1.73 g/cm3 that depending on an increasing of bias voltage. The
hardness was proportional to the true density of films. In addition, the
optical properties i.e. refractive index (n) and extinction coefficient (k)
of these films were determined by a spectroscopic ellipsometry (SE)
method that give formation to in 1.62-2.10 (n) and 0.04-0.15 (k)
respectively. These results indicated that the optical properties
confirmed the Raman results as presenting the structure changed with
applied bias voltage increased.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this research, n-dodecylthiol was added to P3HT/ PC70BM polymer solar cells to improve the crystallinity of P3HT and enhance the phase separation of P3HT/PC70BM. The improved crystallinity of P3HT:PC70BM doped with 0-5% by volume of n-dodecylthiol resulted in improving the power conversion efficiency of polymer solar cells by 33%. In addition, thermal annealing of the P3HT/PC70MB/n-dodecylthiolcompound showed further improvement in crystallinity with n-dodecylthiol concentration up to 2%. The highest power conversion efficiency of 3.21% was achieved with polymer crystallites size L of 11.2nm, after annealing at 150°C for 30 minutes under a vacuum atmosphere. The smaller crystallite size suggests a shorter path of the charge carriers between P3HT backbones, which could be beneficial to getting a higher short circuit current in the devices made with the additive.
Abstract: Extreme rainfall frequency analysis for Meteorological Sub-Division 4 of India was analyzed using L-moments approach. Serial Correlation and Mann Kendall tests were conducted for checking serially independent and stationarity of the observations. The discordancy measure for the sites was conducted to detect the discordant sites. The regional homogeneity was tested by comparing with 500 generated homogeneous regions using a 4 parameter Kappa distribution. The best fit distribution was selected based on ZDIST statistics and L-moments ratio diagram from the five extreme value distributions GPD, GLO, GEV, P3 and LP3. The LN3 distribution was selected and regional rainfall frequency relationship was established using index-rainfall procedure. A regional mean rainfall relationship was developed using multiple linear regression with latitude and longitude of the sites as variables.
Abstract: This analysis of Kuosheng nuclear power plant (NPP)
was performed mainly by TRACE, assisted with FRAPTRAN and
FRAPCON. SNAP v2.2.1 and TRACE v5.0p3 are used to develop the
Kuosheng NPP SPU TRACE model which can simulate the turbine
trip without bypass transient. From the analysis of TRACE, the
important parameters such as dome pressure, coolant temperature and
pressure can be determined. Through these parameters, comparing
with the criteria which were formulated by United States Nuclear
Regulatory Commission (U.S. NRC), we can determine whether the
Kuoshengnuclear power plant failed or not in the accident analysis.
However, from the data of TRACE, the fuel rods status cannot be
determined. With the information from TRACE and burn-up analysis
obtained from FRAPCON, FRAPTRAN analyzes more details about
the fuel rods in this transient. Besides, through the SNAP interface, the
data results can be presented as an animation. From the animation, the
TRACE and FRAPTRAN data can be merged together that may be
realized by the readers more easily. In this research, TRACE showed
that the maximum dome pressure of the reactor reaches to 8.32 MPa,
which is lower than the acceptance limit 9.58 MPa. Furthermore,
FRAPTRAN revels that the maximum strain is about 0.00165, which
is below the criteria 0.01. In addition, cladding enthalpy is 52.44 cal/g
which is lower than 170 cal/g specified by the USNRC NUREG-0800
Standard Review Plan.
Abstract: The coherent Self-Averaging (CSA), is a new method proposed in this work; applied to simulated signals evoked potentials related to events (ERP) to find the wave P300, useful systems in the brain computer interface (BCI). The CSA method cleans signal in the time domain of white noise through of successive averaging of a single signal. The method is compared with the traditional method, coherent averaging or synchronized (CA), showing optimal results in the improvement of the signal to noise ratio (SNR). The method of CSA is easy to implement, robust and applicable to any physiological time series contaminated with white noise
Abstract: We examined the crop yield results of hybrids in 2012. We found out that in the control treatments the lowest yield was reached with the hybrid PR37M81: 10,012 kg ha-1. The highest yield was in case of hybrid P37N01: 11,581 kg ha-1. As we raised the nutrient doses the lowest yield of all examined nutrient levels was in case of hybrid PR37M81. We measured at N60+PK nutrient level 12,517 kg ha-1, at N120+PK nutrient level 12,760 kg ha-1, and at N150+PK nutrient level 12,535 kg ha-1 yield results. At N60+PK and N120+PK nutrient level the highest yield was reached with the hybrid P9494 (N60+PK: 13,970 kg ha-1, N120+PK: 13,871 kg ha-1). In case of the N150+PK fertilization treatment the hybrid P37N01 gave the highest yield results (13,962 kg ha-1).
Abstract: Heme oxygenase-1 (HO-1), an enzyme degrading heme to carbon monoxide, iron, and biliverdin, has been recognized as playing a crucial role in cellular defense against stressful conditions, not only related to heme release. In the present study, the effects of TNF-a on the expression of heme oxygenase-1 (HO-1) in human aortic endothelial cells (HAECs) as well as the related mechanisms were investigated. 10 ng/mL TNF-α treatment significantly increased HO-1 expression after 6h, then a further increase at 12h and declined at 24h. Treatment with 2 ng/mL of TNF-a after 12 h resulted in a significant increase in HO-1 expression, which peaked at 10 ng/mL, then declined at 20 ng/mL. TNF-α induced HO-1 expression and then HO-1 expression reduced vascular cell adhesion molecule-1 (VCAM-1) expression. Phosphorylation studies of ERK1/2, JNK, and p38, three subgroups of mitogen-activated protein kinases (MAPKs) demonstrated TNF-α-induced ERK1/2, JNK, and p38 phosphorylation. The increase in HO-1 expression in response to TNF-α treatment was affected by pretreatment with SP600125 (a JNK inhibitor) and SB203580 (a p38 inhibitor), not with PD98059 (an ERK1/2 inhibitor). The expression of HO-1 was stronger in aortas of TNF-α-treated apo-E deficient mice when compared with control mice. These results suggest that low dose of TNF-α treatment notably induced HO-1 expression was mediated through JNK/p38 phosphorylation and may have a protective potential in cardiovascular diseases and inflammatory response through the regulation of HO-1 expression.
Abstract: In this paper, we present a non-blind technique of
adding the watermark to the Fourier spectral components of audio
signal in a way such that the modified amplitude does not exceed the
maximum amplitude spread (MAS). This MAS is due to individual
Discrete fourier transform (DFT) coefficients in that particular frame,
which is derived from the Energy Spreading function given by
Schroeder. Using this technique one can store double the information
within a given frame length i.e. overriding the watermark on the
host of equal length with least perceptual distortion. The watermark
is uniformly floating on the DFT components of original signal.
This helps in detecting any intentional manipulations done on the
watermarked audio. Also, the scheme is found robust to various signal
processing attacks like presence of multiple watermarks, Additive
white gaussian noise (AWGN) and mp3 compression.
Abstract: Maximal length sequences (m-sequences) are also
known as pseudo random sequences or pseudo noise sequences
for closely following Golomb-s popular randomness properties: (P1)
balance, (P2) run, and (P3) ideal autocorrelation. Apart from these,
there also exist certain other less known properties of such sequences
all of which are discussed in this tutorial paper. Comprehensive proofs
to each of these properties are provided towards better understanding
of such sequences. A simple test is also proposed at the end of
the paper in order to distinguish pseudo noise sequences from truly
random sequences such as Bernoulli sequences.
Abstract: Currently, many types of no-reversible compressed
sound source, represented by MP3 (MPEG Audio Layer-3) are
popular in the world and they are widely used to make the music file
size smaller. The sound data created in this way has less information as
compared to pre-compressed data. The objective of this study is by
analyzing EEG to determine if people can recognize such difference as
differences in sound. A measurement system that can measure and
analyze EEG when a subject listens to music were experimentally
developed. And ten subjects were studied with this system. In this
experiment, a WAVE formatted music data and a MP3 compressed
music data that is made from the WAVE formatted data were
prepared. Each subject was made to hear these music sources at the
same volume. From the results of this experiment, clear differences
were confirmed between two wound sources.
Abstract: Zinc oxide thin films with various microstructures
were grown on substrates by using HCOOH-sols. The reaction
mechanism of the sol system was investigated by performing an XPS
analysis of as-synthesized films, due to the products of hydrolysis
and condensation in the sol system contributing to the chemical state
of the as-synthesized films. The chemical structures of the assynthesized
films related to the microstructures of the final annealed
films were also studied. The results of the Zn 2p3/2, C 1s and O1s
XPS patterns indicate that the hydrolysis reaction in the sol system is
strongly influenced by the HCOOH agent. The results of XRD and
FE-SEM demonstrated the microstructures of the annealed films are
related to the content of hydrolyzed zinc hydrate (Zn-OH) species
present, and that content of the Zn-OH species in the sol system
increases the HCOOH adding, and these Zn-OH species existing in
the sol phase are responsible for large ZnO crystallites in the final
annealed films.
Abstract: The research was set up on chernozem soil at the Látókép AGTC MÉK research area of the University of Debrecen in Hungary. We examined the yield, the yield production per 1kg NPK fertilizer and the water and nutrient utilization of hybrid PR37N01 and PR37M81 in 2013. We found that PR37N01 produced the most yield at the level of N120+P (17,476kg ha-1) while PR37M81 reached the highest yield at level N150+PK (16,754kg ha-1). Studies related to yield production per 1kg NPK indicated that the best results were achieved at level N30+PK compared to the control treatment. Yield production per 1kg NPK was17.6kg kg-1 by P37N01 and 44.2kg kg-1 by PR37M81. By comparing the water utilization of hybrids we found that the worst water utilization results were reached in the control treatment (PR37N01: 26.2kg mm-1, PR37M81: 19.5kg mm-1). The best water utilization values were produced at level N120+PK in the case of hybrid PR37N01 (32.1kg mm-1) and at N150+PK in the case of hybrid PR37M81 (30.8kg mm-1). We established the values of the nutrient reaction and the fertilizer optimum of hybrids. We discovered a strong relationship between the amount of fertilizer applied and the yield produced (r2= 0.8228–0.9515). The best nutrient response was induced by hybrid PR37N01, while the weakest results were reached by hybrid PR37M81.
Abstract: The development and use of mobile devices as well as its integration within education systems to deliver electronic contents and to support real-time communications was the focus of this research. In order to investigate the software engineering issues in using mobile devices a research on electronic content was initiated. The Developed MP3 mobile software solution was developed as a prototype for testing and developing a strategy for designing a usable m-learning environment. The mobile software solution was evaluated using mobile device using the link: http://projects.seeu.edu.mk/mlearn. The investigation also tested the correlation between the two mobile learning indicators: electronic content and attention, based on the Task Based learning instructional method. The mobile software solution ''M-Learn“ was developed as a prototype for testing the approach and developing a strategy for designing usable m-learning environment. The proposed methodology is about what learning modeling approach is more appropriate to use when developing mobile learning software.
Abstract: In this work, we present for the first time in our
perception an efficient digital watermarking scheme for mpeg audio
layer 3 files that operates directly in the compressed data domain,
while manipulating the time and subband/channel domain. In
addition, it does not need the original signal to detect the watermark.
Our scheme was implemented taking special care for the efficient
usage of the two limited resources of computer systems: time and
space. It offers to the industrial user the capability of watermark
embedding and detection in time immediately comparable to the real
music time of the original audio file that depends on the mpeg
compression, while the end user/audience does not face any artifacts
or delays hearing the watermarked audio file. Furthermore, it
overcomes the disadvantage of algorithms operating in the PCMData
domain to be vulnerable to compression/recompression attacks,
as it places the watermark in the scale factors domain and not in the
digitized sound audio data. The strength of our scheme, that allows it
to be used with success in both authentication and copyright
protection, relies on the fact that it gives to the users the enhanced
capability their ownership of the audio file not to be accomplished
simply by detecting the bit pattern that comprises the watermark
itself, but by showing that the legal owner knows a hard to compute
property of the watermark.
Abstract: In this paper, the wear of high speed steel hobs during
hobbing has been studied. The wear mechanisms are strongly
influenced by the choice of cutting speed. At moderate and high
cutting speeds three major wear mechanisms were identified:
abrasion, mild adhesive and severe adhesive. The microstructure and
wear behavior of two high speed steel grades (M2 and ASP30) has
been compared. In contrast, a variation in chemical composition or
microstructure of HSS tool material generally did not change the
dominant wear mechanism. However, the tool material properties
determine the resistance against the operating wear mechanism and
consequently the tool life. The metallographic analysis and wear
measurement at the tip of hob teeth included scanning electron
microscopy and stereoscope microscopy. Roughness profilometery is
used for measuring the gear surface roughness.
Abstract: In this paper a novel scheme for watermarking digital
audio during its compression to MPEG-1 Layer III format is
proposed. For this purpose we slightly modify some of the selected
MDCT coefficients, which are used during MPEG audio
compression procedure. Due to the possibility of modifying different
MDCT coefficients, there will be different choices for embedding the
watermark into audio data, considering robustness and transparency
factors. Our proposed method uses a genetic algorithm to select the
best coefficients to embed the watermark. This genetic selection is
done according to the parameters that are extracted from the
perceptual content of the audio to optimize the robustness and
transparency of the watermark. On the other hand the watermark
security is increased due to the random nature of the genetic
selection. The information of the selected MDCT coefficients that
carry the watermark bits, are saves in a database for future extraction
of the watermark. The proposed method is suitable for online MP3
stores to pursue illegal copies of musical artworks. Experimental
results show that the detection ratio of the watermarks at the bitrate
of 128kbps remains above 90% while the inaudibility of the
watermark is preserved.
Abstract: A spectrophotometric method was developed for simultaneous quantification of pseudoephedrine hydrochloride (PSE) triprolidine hydrochloride (TRI) using second derivative method (zero-crossing technique). The second derivative amplitudes of PSE and TRI were measured at 271 and 321 nm, respectively. The calibration curves were linear in the range of 200 to 1,000 g/ml for PSE and 10 to 50 g/ml for TRI. The method was validated for specificity, accuracy, precision, limit of detection and limit of quantitation. The proposed method was applied to the assaying and dissolution of PSE and TRI in commercial tablets without any chemical separation. The results were compared with those obtained by the official USP31 method and statistical tests showed that there is no significant between the methods at 95% confidence level. The proposed method is simple, rapid and suitable for the routine quality control application. KeywordsTriprolidine, Pseudoephedrine, Derivative spectrophotometry, Dissolution testing.