Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.
Abstract: The paper presents a part of the results obtained in a
complex research project on Romanian Grey Steppe breed, owner of
some remarkable qualities such as hardiness, longevity, adaptability,
special resistance to ban weather and diseases and included in the
genetic fund (G.D. no. 822/2008.) from Romania.
Following the researches effectuated, we identified alleles of six
loci, codifying the six types of major milk proteins: alpha-casein S1
(α S1-cz); beta-casein (β-cz); kappa-casein (K-cz); beta-lactoglobulin
(β-lg); alpha-lactalbumin (α-la) and alpha-casein S2 (α S2-cz). In
system αS1-cz allele αs1-Cn B has the highest frequency (0.700), in
system β-cz allele β-Cn A2 ( 0.550 ), in system K-cz allele k-CnA2 (
0.583 ) and heterozygote genotype AB ( 0.416 ) and BB (0.375), in
system β-lg allele β-lgA1 has the highest frequency (0.542 ) and
heterozygote genotype AB ( 0.500 ), in system α-la there is
monomorphism for allele α-la B and similarly in system αS2-cz for
allele αs2-Cn A.
The milk analysis by the isoelectric focalization technique (I.E.F.)
allowed the identification of a new allele for locus αS1-casein, for two
of the individuals under analysis, namely allele called αS1-casein
IRV. When experiments were repeated, we noticed that this is not a
proteolysis band and it really was a new allele that has not been
registered in the specialized literature so far. We identified two
heterozygote individuals, carriers of this allele, namely: BIRV and
CIRV. This discovery is extremely important if focus is laid on the
national genetic patrimony.
Abstract: A lot of recent research have spoken on the relation
between the increase of the homocysteinemia and some kinds of
cancer . For that, our study was based on the research of a possible
relation between the increase of the concentration of this amino-acid
in the plasma and the appearance of the disease of the Acute
Lymphoblastic Leukaemia in a part of Algerian children with Berber
origin in the East of Algeria . The study has done on 47 ill persons
with an average age of (09±06 ) years , with whom the disease has
diagnosed by blood and marrow examination in the hospital of blood
diseases in the CHU of Batna, and on 194 healthy witnesses of the
same age. The two groups were benefited by a dosage of the
concentration of the homocysteine vitamin B9 ,vitamin B12 , and
also of the study of special polymorphisms of indispensable enzymes
in the metabolism of this acid , and that by the use of the method (
Light cycler ) Real time PCR , on the following enzymes : MS (
C2756G ), MSR ( A66G ) ,MTHFR1 ( C677T ) and MTHFR2
(A1298C). The obtained results have revealed that the rate of the
homozygote muted genotype is the less frequent in the two groups ,
and that exist at list one genotype of each enzyme in the ill group and
in which the percentage exceed with remarkable way the same
genotype in the healthy group and we notice specially the muted
genotype GG of -the methionine synthetase-and the form TT of the
enzyme – methyline tetra hydrofolate reductase – We notice the
existence of considerable number of genotypes in the ill group lied
with characteristic increase of this Amino-acid ,and that for the
reduction of the biologic activity of these enzymes which become
inefficient in the transfer of the homocysteine into the methionine
and cause the diminution of the biologic activity of these enzymes
and with consequence the reduction of the percentage of methylic
radicals in the DNA of studied genes and that lead to the increase of
the activity and the capacity of transcription , and it-s so probably
that this last one is one of the factors of this disease especially if we
know that the specific check-up of vitamins is normal and similar in
the two groups , which ovoid the hypothesis of the reduction of
vitamins . We notice also that the heterozygote genotype is the less in
the sick category except the MTHFR2. Wild genotype is more
frequent in the witness group except MSR. Even these results are
partials; they open a new way in the genetic diagnosis of this
malicious disease which allow a precocious diagnosis and the use of
an effective and appropriated treatment in the same time.
Abstract: The paper makes part from a complex research project
on Romanian Grey Steppe, a unique breed in terms of biological and
cultural-historical importance, on the verge of extinction and which
has been included in a preservation programme of genetic resources
from Romania. The study of genetic polymorphism of protean
fractions, especially kappa-casein, and the genotype relations of
these lactoproteins with some quantitative and qualitative features of
milk yield represents a current theme and a novelty for this breed. In
the estimation of the genetic parameters we used R.E.M.L.
(Restricted Maximum Likelihood) method.
The main lactoprotein from milk, kappa - casein (K-cz),
characterized in the specialized literature as a feature having a high
degree of hereditary transmission, behaves as such in the nucleus under
study, a value also confirmed by the heritability coefficient (h2 = 0.57
%). We must mention the medium values for milk and fat quantity
(h2=0.26, 0.29 %) and the fat and protein percentage from milk
having a high hereditary influence h2 = 0.71 - 0.63 %.
Correlations between kappa-casein and the milk quantity are
negative and strong. Between kappa-casein and other qualitative
features of milk (fat content 0.58-0.67 % and protein content 0.77-
0.87%), there are positive and very strong correlations. At the same
time, between kappa-casein and β casein (β-cz), β lactoglobulin (β-
lg) respectively, correlations are positive having high values (0.37 –
0.45 %), indicating the same causes and determining factors for the
two groups of features.