Abstract: Graves’ Disease (GD), an autoimmune health condition caused by the over reactiveness of the thyroid, affects about 1 in 200 people worldwide. GD is not caused by one specific single nucleotide polymorphism (SNP) or gene mutation, but rather determined by multiple factors, each differing from each other. Malfunction of the genes in Human Leukocyte Antigen (HLA) family tend to play a major role in autoimmune diseases, but other genes, such as LOC101929163, have functions that still remain ambiguous. Currently, little studies were done to study GD, resulting in inconclusive results. This study serves not only to introduce background knowledge about GD, but also to organize and pinpoint the major SNPs and genes that are potentially related to the occurrence of GD in humans. Collected from multiple sources from genome-wide association studies (GWAS) Central, the potential SNPs related to the causes of GD are included in this study. This study has located the genes that are related to those SNPs and closely examines a selected sample. Using the data from this study, scientists will then be able to focus on the most expressed genes in GD patients and develop a treatment for GD.
Abstract: The purpose of this work was to synthesize and investigate phase formation, structure and thermophysical properties of the phosphates M0.5+xM'xZr2–x(PO4)3 (M – Cd, Sr, Pb; M' – Mg, Co, Mn). The compounds were synthesized by sol-gel method. The results showed formation of limited solid solutions of NZP/NASICON type. The crystal structures of triple phosphates of the compositions MMg0.5Zr1.5(PO4)3 were refined by the Rietveld method using XRD data. Heat capacity (8–660 K) of the phosphates Pb0.5+xMgxZr2-x(PO4)3 (x = 0, 0.5) was measured, and reversible polymorphic transitions were found at temperatures, close to the room temperature. The results of Rietveld structure refinement showed the polymorphism caused by disordering of lead cations in the cavities of NZP/NASICON structure. Thermal expansion (298−1073 K) of the phosphates MMg0.5Zr1.5(PO4)3 was studied by XRD method, and the compounds were found to belong to middle and low-expanding materials. Thermal diffusivity (298–573 K) of the ceramic samples of phosphates slightly decreased with temperature increasing. As was demonstrated, the studied phosphates are characterized by the better thermophysical characteristics than widespread fire-resistant materials, such as zirconia and etc.
Abstract: Background: Inter-individual variation in response to metformin, which has been considered as a first line therapy for T2DM treatment is considerable. In the current study, it was aimed to investigate the impact of two genetic variants Leu125Phe (rs77474263) and Gly64Asp (rs77630697) in gene SLC47A1 on the clinical efficacy of metformin in T2DM Pakistani patients. Methods: The study included 800 T2DM patients (400 metformin responders and 400 metformin non-responders) along with 400 ethnically matched healthy individuals. The genotypes were determined by allele-specific polymerase chain reaction. In-silico analysis was done to confirm the effect of the two SNPs on the structure of genes. Association was statistically determined using SPSS software. Results: Minor allele frequency for rs77474263 and rs77630697 was 0.13 and 0.12. For SLC47A1 rs77474263 the homozygotes of one mutant allele ‘T’ (CT) of rs77474263 variant were fewer in metformin responders than metformin non-responders (29.2% vs. 35.5 %). Likewise, the efficacy was further reduced (7.2% vs. 4.0 %) in homozygotes of two copies of ‘T’ allele (TT). Remarkably, T2DM cases with two copies of allele ‘C’ (CC) had 2.11 times more probability to respond towards metformin monotherapy. For SLC47A1 rs77630697 the homozygotes of one mutant allele ‘A’ (GA) of rs77630697 variant were fewer in metformin responders than metformin non-responders (33.5% vs. 43.0 %). Likewise, the efficacy was further reduced (8.5% vs. 4.5%) in homozygotes of two copies of ‘A’ allele (AA). Remarkably, T2DM cases with two copies of allele ‘G’ (GG) had 2.41 times more probability to respond towards metformin monotherapy. In-silico analysis revealed that these two variants affect the structure and stability of their corresponding proteins. Conclusion: The present data suggest that SLC47A1 Leu125Phe (rs77474263) and Gly64Asp (rs77630697) polymorphisms were associated with the therapeutic response of metformin in T2DM patients of Pakistan.
Abstract: Both Betong chicken (KU Line) and Thai Native chickens were the high quality of the meat and low carcass fat compared to broiler chickens. The objective of this study was to determine the growth performance, carcass characteristic, meat quality and association of polymorphism in the ApoVLDL-II gene with fat accumulation in the female broiler, Thai Native and Betong (KU line) chickens at 4-14 weeks. The chickens were used and reared under the same environment and management (100 chicks per breed). The results showed that body weight (BW) of broiler chickens was significantly higher than Thai Native and Betong (KU line) chickens (P < 0.01) through all the experiment. At 4-8 weeks of age, feed conversion ratio (FCR) of broiler chickens was significantly better than Thai Native and Betong (KU line) chickens (P < 0.01), then increased at week 8-14. The percentage of breast, abdominal fat and subcutaneous fat of broiler chickens was significantly greater than Thai Native and Betong (KU line) chickens (P < 0.01). However, Thai Native chickens showed the highest percentage of liver (P < 0.01) when compared to other breeds. In addition, the percentage of wing of Thai Native and Betong (KU line) chickens were significantly (P < 0.01) higher than broiler chickens. Meat quality was also determined and found that, pH of breast meat left from slaughter 45 minutes (pH45) and 24 hours (pH24) of broiler was significantly higher than Thai Native and Betong (KU line) (P < 0.01) whereas the percentage of drip loss, thawing loss, cooking loss and shear force was not significantly different between breeds. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to genotype the polymorphism in the ApoVLDL-II gene in the broiler, Thai Native and Betong (KU line) chickens. The results found that, the polymorphism in the ApoVLDL-II gene at VLDL6 loci was not associated with fat accumulation in those studied population.
Abstract: Genetic structure is very important to understand the brain dopamine system which is related to athletic performance. Hopefully, there will be enough studies about athletics performance in the terms of addiction-related genetic markers in the future. In the present study, we intended to investigate the Receptor-2 Gene (DRD2) rs1800497, which is related to brain dopaminergic system. 10 sprinter and 10 endurance athletes were enrolled in the study. Real-Time Polymerase Chain Reaction method was used for genotyping. According to results, A1A1, A1A2 and A2A2 genotypes in athletes were 0 (%0), 3 (%15) and 17 (%85). A1A1 genotype was not found and A2 allele was counted as the dominating allele in our cohort. These findings show that dopaminergic mechanism effects on sport genetic may be explained by the polygenic and multifactorial view.
Abstract: Some Metapenaeus monoceros cox1 gene fragments were isolated, purified, sequenced, and comparatively analyzed with some other Crustacean Cox1 gene sequences (obtained from National Center for Biotechnology Information). This work was designed for testing the efficiency of this system in reconstruction of phylogenetic relations among some Crustacean species belonging to four genera (Metapenaeus, Artemia, Daphnia and Calanus). The single nucleotide polymorphism and haplotype diversity were calculated for all estimated mt-DNA fragments. The genetic distance values were 0.292, 0.015, 0.151, and 0.09 within Metapenaeus species, Calanus species, Artemia species, and Daphnia species, respectively. The reconstructed phylogenetic tree is clustered into some unique clades. Cytochrome oxidase subunit 1 gene (cox1) was a powerful system in reconstruction of phylogenetic relations among evaluated crustacean species.
Abstract: The objective of the present study was to determine the polymorphism in the leptin (332G>A) and its association with biometric traits in Sanjabi sheep. For this purpose, blood samples from 96 rams were taken, and tail length, width tail, circumference tail, body length, body width, and height were simultaneously recorded. PCR was performed using specific primer to amplify 463 bp fragment including exon 3 of leptin gene, and PCR products were digested by Cail restriction enzymes. The 332G>A (at 332th nucleotide of exon 3 leptin gene) that caused an amino acid change from Arg to Gln was detected by Cail (CAGNNNCTG) endonuclease, as the endonuclease cannot cut this region if G nucleotide is located in this position. Three genotypes including GG (463), GA (463, 360and 103 bp) and GG (360 bp and 103 bp) were identified after digestion by enzyme. The estimated frequencies of three genotypes including GG, GA, and AA for 332G>A locus were 0.68, 0.29 and 0.03 and those were 0.18 and 0.82 for A and G alleles, respectively. In the current study, chi-square test indicated that 332G>A positions did not deviate from the Hardy–Weinberg (HW) equilibrium. The most important reason to show HW equation was that samples used in this study belong to three large local herds with a traditional breeding system having random mating and without selection. Shannon index amount was calculated which represent an average genetic variation in Sanjabi rams. Also, heterozygosity estimated by Nei index indicated that genetic diversity of mutation in the leptin gene is moderate. Leptin gene polymorphism in the 332G>A had significant effect on body length (P0.05). This non-synonymous SNP resulted in different amino acid changes at codon positions111(R/Q). As leptin activity is localized, at least in part, in domains between amino acid residues 106-1406, it is speculated that the detected SNP at position 332 may affect the activity of leptin and may lead to different biological functions. Based to our results, due to significant effect of leptin gene polymorphism on body size traits, this gene may be used a candidate gene for improving these traits.
Abstract: κ-casein is one of milk proteins which are very important for milk processing. Genotypes of κ-casein affect milk yield, fat, and protein content. The main factors which affect local Latvian dairy breed milk yield and composition are analyzed in research. Data were collected from 88 Latvian brown and 82 Latvian blue cows in 2015. AA genotype was 0.557 in Latvian brown and 0.232 in Latvian blue breed. BB genotype was 0.034 in Latvian brown and 0.207 in Latvian blue breed. Highest milk yield was observed in Latvian brown (5131.2 ± 172.01 kg), significantly high fat content and fat yield also was in Latvian brown (p < 0.05). Significant differences between κ-casein genotypes were not found in Latvian brown, but highest milk yield (5057 ± 130.23 kg), protein content (3.42 ± 0.03%), and protein yield (171.9 ± 4.34 kg) were with AB genotype. Significantly high fat content was observed in Latvian blue breed with BB genotype (4.29 ± 0.17%) compared with AA genotypes (3.42 ± 0.19). Similar tendency was found in protein content – 3.27 ± 0.16% with BB genotype and 2.59 ± 0.16% with AA genotype (p < 0.05). Milk yield increases by increasing parity. We did not obtain major tendency of changes of milk fat and protein content according parity.
Abstract: Apolipoprotein E (APOE) gene polymorphism has influence on serum lipids which relates to cardiovascular risk. The purpose of this study was to determine the frequency distribution of APOE alleles among Malaysian Type 2 Diabetes Mellitus (DM) patients with and without coronary artery disease (CAD) and their association with serum lipid profiles. A total of 115 patients were recruited in which 78 patients had Type 2 DM without CAD and 37 patients had Type 2 DM with CAD. The APOE polymorphism was detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The APOE ɛ3 allele was the most common one in both groups. There was no significant association between the APOE genotypes and the CAD status in Type 2 DM using Pearson χ2 test. Further analysis indicated there were no significant differences in all lipid parameters between E2, E3 and E4 subgroups in both groups. The study showed that the E4 allele carriers of Type 2 DM with CAD patients had higher LDL-C level and lower HDL-C level compared to the other allele carriers. However, analyses showed these levels were not statistically different. The study also showed that the Type 2 DM with CAD group with E2 allele had higher triglyceride (TG). In conclusion, further study with larger sample size is needed to confirm role of E4 as a marker of CAD among Type 2 DM patients in Malaysian population.
Abstract: Canna indica is a prominent species complex in tropical and subtropical areas. They become indigenous in Southeast Asia where they have been introduced. At present, C. indica complex comprises over hundred hybrids, are cultivated as commercial horticulture. The species complex contains starchy rhizome having economic value in terms of food and herbal medicine. In addition, bright color of the flowers makes it a valuable ornamental plant and potential source for natural colorant. This study aims to assess genetic diversity of four varieties of C. indica complex based on SRAP (sequence-related amplified polymorphism) and iPBS (inter primer binding site) markers. We also examined phytochemical characteristics and antioxidant properties of the flower extracts from four different color varieties. Results showed that despite of the genetic variation, there were no significant differences in phytochemical characteristics and antioxidant properties of flowers. The SRAP and iPBS results agree with the more primitive traits showed by morphological information and phytochemical and antioxidant characteristics from the flowers. Since Canna flowers has long been used as natural colorants together with the antioxidant activities from the ethanol extracts in this study, there are likely to be good source for cosmetics additives.
Abstract: As genetic diversity is most important for existing, breeding and production of any fish; this study was undertaken for investigating genetic diversity of freshwater mud eel, Monopterus cuchia at population level where three ecological populations such as flooded area of Sylhet (P1), open water of Moulvibazar (P2) and open water of Sunamganj (P3) districts of Bangladesh were considered. Four arbitrary RAPD primers (OPB-12, C0-4, B-03 and OPB-08) were screened and RAPD banding patterns were analyzed among the populations considering 15 individuals of each population. In total 174, 138 and 149 bands were detected in the populations of P1, P2 and P3 respectively; however, each primer revealed less number of bands in each population. 100% polymorphic loci were recorded in P2 and P3 whereas only one monomorphic locus was observed in P1, recorded 97.5% polymorphism. Different genetic parameters such as inter-individual pairwise similarity, genetic distance, Nei genetic similarity, linkage distances, cluster analysis and allelic information, etc. were considered for measuring genetic diversity. The average inter-individual pairwise similarity was recorded 2.98, 1.47 and 1.35 in P1, P2 and P3 respectively. Considering genetic distance analysis, the highest distance 1 was recorded in P2 and P3 and the lowest genetic distance 0.444 was found in P2. The average Nei genetic similarity was observed 0.19, 0.16 and 0.13 in P1, P2 and P3, respectively; however, the average linkage distance was recorded 24.92, 17.14 and 15.28 in P1, P3 and P2 respectively. Based on linkage distance, genetic clusters were generated in three populations where 6 clades and 7 clusters were found in P1, 3 clades and 5 clusters were observed in P2 and 4 clades and 7 clusters were detected in P3. In addition, allelic information was observed where the frequency of p and q alleles were observed 0.093 and 0.907 in P1, 0.076 and 0.924 in P2, 0.074 and 0.926 in P3 respectively. The average gene diversity was observed highest in P2 (0.132) followed by P3 (0.131) and P1 (0.121) respectively.
Abstract: Meat Tenderness is one of the most important factors affecting consumers' assessment of meat quality. Variation in meat tenderness is genetically controlled and varies among breeds, and it is also influenced by environmental factors that can affect its creation during rigor mortis and postmortem. The final postmortem meat tenderization relies on the extent of proteolysis of myofibrillar proteins caused by the endogenous activity of the proteolytic calpain system. This calpain system includes different calcium-dependent cysteine proteases, and an inhibitor, calpastatin. It is widely accepted that in farm animals including chickens, the μ-calpain gene (CAPN1) is a physiological candidate gene for meat tenderness. This study aimed to identify the association of single nucleotide polymorphism (SNP) markers in the CAPN1 gene with the tenderness of chicken breast meat from two Malaysian native and commercial broiler breed crosses. Ten, five months old native chickens and ten, 42 days commercial broilers were collected from the local market and breast muscles were removed two hours after slaughter, packed separately in plastic bags and kept at -20ºC for 24 h. The tenderness phenotype for all chickens’ breast meats was determined by Warner-Bratzler Shear Force (WBSF). Thawing and cooking losses were also measured in the same breast samples before using in WBSF determination. Polymerase chain reaction (PCR) was used to identify the previously reported C7198A and G9950A SNPs in the CAPN1 gene and assess their associations with meat tenderness in the two breeds. The broiler breast meat showed lower shear force values and lower thawing loss rates than the native chickens (p
Abstract: The paper presents the results of the molecular
genetics analysis in sports research, with special emphasis to use
genetic information in diagnosing of motoric predispositions in Roma
boys from East Slovakia. The ability and move are the basic
characteristics of all living organisms. The phenotypes are influenced
by a combination of genetic and environmental factors. Genetic tests
differ in principle from the traditional motoric tests, because
the DNA of an individual does not change during life. The aim of
the presented study was to examine motion abilities and to determine
the frequency of ACTN3 (R577X) gene in Roma children. Genotype
data were obtained from 138 Roma and 155 Slovak boys from 7 to 15
years old. Children were investigated on physical performance level
in association with their genotype. Biological material for genetic
analyses comprised samples of buccal swabs. Genotypes were
determined using Real Time High resolution melting PCR method
(Rotor-Gene 6000 Corbett and Light Cycler 480 Roche). The
software allows creating reports of any analysis, where information
of the specific analysis, normalized and differential graphs and many
information of the samples are shown. Roma children of analyzed
group legged to non-Romany children at the same age in all the
compared tests. The % distribution of R and X alleles in Roma
children was different from controls. The frequency of XX genotype
was 9.26%, RX 46.33% and RR was 44.41%. The frequency of XX
genotype was 9.26% which is comparable to a frequency of an Indian
population. Data were analyzed with the ANOVA test.
Abstract: Due to its high computational cost, mutation testing has been neglected by researchers. Recently, many cost and mutants’ reduction techniques have been developed, improved, and experimented, but few of them has relied the possibility of reducing the cost of mutation testing on the program type of the application under test. This paper is a comparative study between four operators’ selection techniques (mutants sampling, class level operators, method level operators, and all operators’ selection) based on the program code type of each application under test. It aims at finding an alternative approach to reveal the effect of code type on mutation testing score. The result of our experiment shows that the program code type can affect the mutation score and that the programs using polymorphism are best suited to be tested with mutation testing.
Abstract: Polymorphism is one of the main pillars of objectoriented
paradigm. It induces hidden forms of class dependencies
which may impact software quality, resulting in higher cost factor for
comprehending, debugging, testing, and maintaining the software. In
this paper, a new cognitive complexity metric called Cognitive
Weighted Polymorphism Factor (CWPF) is proposed. Apart from the
software structural complexity, it includes the cognitive complexity
on the basis of type. The cognitive weights are calibrated based on 27
empirical studies with 120 persons. A case study and experimentation
of the new software metric shows positive results. Further, a
comparative study is made and the correlation test has proved that
CWPF complexity metric is a better, more comprehensive, and more
realistic indicator of the software complexity than Abreu’s
Polymorphism Factor (PF) complexity metric.
Abstract: Cesium molybdates with general formula
CsMIII(MoO4)2, where MIII = Bi, Dy, Pr, Er, exhibit rich
polymorphism, and crystallize in a layered structure. These properties
cause intensive studies on cesium molybdates. CsBi(MoO4)2 was synthesized by microwave method by using
cerium sulphate, bismuth oxide and molybdenum (VI) oxide in an
appropriate molar ratio. Characterizations were done by x-ray
diffraction (XRD), fourier transform infrared (FTIR) spectroscopy,
scanning electron microscopy/energy dispersive analyze (SEM/EDS),
thermo gravimetric/differantial thermal analysis (TG/DTA).
Abstract: Monoamine oxidase A gene (MAOA) is suggested to
be a candidate gene implicated in many neuropsychiatric disorders,
including autism spectrum disorder (ASD). This meta-analytic review
evaluates the relationship between ASD and MAOA markers such as
30 bp variable number tandem repeats in the promoter region
(uVNTR) and single nucleotide polymorphisms (SNPs) by using
findings from recently published studies. It seems that in Caucasian
males, the risk of developing ASD increase with the presence of 4-
repeat allele in the promoter region of MAOA gene whereas no
differences were found between autistic patients and controls in
Egyptian, West Bengal and Korean population. Some studies point to
the importance of specific haplotype groups of SNPs and interaction
of MAOA with others genes (e. g. FOXP2 or SRY). The results of
existing studies are insufficient and further research is needed.
Abstract: Domestic goats (Capra hircus) are extremely diverse
species and principal animal genetic resource of the developing
world. These facilitate a persistent supply of meat, milk, fibre, and
skin and are considered as important revenue generators in small
pastoral environments. This study aimed to fingerprint β-LG gene at
PCR-RFLP level in native Saudi goat breeds (Ardi, Habsi and Harri)
in an attempt to have a preliminary image of β-LG genotypic patterns
in Saudi breeds as compared to other foreign breeds such as Indian
and Egyptian. Also, the Phylogenetic analysis was done to investigate
evolutionary trends and similarities among the caprine β-LG gene
with that of the other domestic specie, viz. cow, buffalo and sheep.
Blood samples were collected from 300 animals (100 for each breed)
and genomic DNA was extracted. A fragment of the β-LG gene
(427bp) was amplified using specific primers. Subsequent digestion
with Sac II restriction endonuclease revealed two alleles (A and B)
and three different banding patterns or genotypes i.e. AA, AB and
BB. The statistical analysis showed a general trend that β-LG AA
genotype had higher milk yield than β-LG AB and β-LG BB
genotypes. Nucleotide sequencing of the selected β-LG fragments
was done and submitted to GenBank NCBI (Accession No.
KJ544248, KJ588275, KJ588276, KJ783455, KJ783456 and
KJ874959). Phylogenetic analysis on the basis of nucleotide
sequences of native Saudi goats indicated evolutional similarity with
the GenBank reference sequences of goat, Bubalus bubalis and Bos
taurus. However, the origin of sheep which is the most closely
related from the evolutionary point of view, was located some
distance away.
Abstract: Osteoporosis is a common multifactorial disease with
a strong genetic component characterized by reduced bone mass and
increased risk of fractures. Genetic factors play an important role in
the pathogenesis of osteoporosis. The aim of our study was to
identify the genotype and allele distribution of T245G polymorphism
in OPG gene in Slovak postmenopausal women. A total of 200
unrelated Slovak postmenopausal women with diagnosed
osteoporosis and 200 normal controls were genotyped for T245G
(rs3134069) polymorphism of OPG gene. Genotyping was performed
using the Custom Taqman®SNP Genotyping assays. Genotypes and
alleles frequencies showed no significant differences (p=0.5551;
p=0.6022). The results of the present study confirm the importance of
T245G polymorphism in OPG gene in the pathogenesis of
osteoporosis.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.