Abstract: This work aimed to examine Oreochromis niloticus fish from Lake Manzala in Port Said, Dakahlya and Damietta governorates, Egypt, as a bio-indicator for the lake water pollution through recording alterations in their hematological, physiological, and histopathological parameters. All fish samples showed a significant increase in levels of alkaline phosphatase (ALP), creatinine and glutathione-S-transferase (GST); only Dakahlya samples showed a significant increase (p
Abstract: This study aimed to determine the possible protective effects of L‐carnitine against gentamicin‐induced nephrotoxicity. Forty male albino rats were divided into 4 groups (10 rats each); Group 1: normal control, group 2: induced nephrotoxicity (gentamicin 50 mg/kg/day S.C; 8 days), group 3: treated with L‐ carnitine (40 mg/kg/d SC for 12 days) and group 4: treated with L‐ carnitine 4 days before and for 8 days in concomitant with gentamicin. Gentamicin‐induced nephrotoxicity (group 2): caused significant increase in serum urea, creatinine, urinary N‐acetyl‐B‐D‐ glucosaminidase (NAG), gamma glutamyl transpeptidase (GGT), urinary total protein and kidney tissue malondialdehyde (MDA) with significant decrease in serum superoxide dismutase (SOD), serum catalase and creatinine clearance and marked tubular necrosis in the proximal convoluted tubules with interruption in the basement membrane around the necrotic tubule compared to the normal control group. L‐carnitine 4 days before and for 8 days in concomitant with gentamicin (group 4) offered marked decrease in serum urea, serum creatinine, urinary NAG, urinary GGT, urinary proteins and kidney tissue MDA, with marked increase in serum SOD, serum catalase and creatinine clearance with marked improvement in the tubular damage compared to gentamicin‐induced nephrotoxicity group. L‐carnitine administered for 12 days produced no change in the parameters mentioned above as compared to the normal control group. In conclusion: L‐carnitine could reduce most of the biochemical parameters and also improve the histopathological features of kidney asscociated with gentamicin induced‐nephrotoxicity.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This study was conducted to examine the possible role of serum Gamma-glutamyltransferase (GGT) and Lactate dehydrogenase (LDH) in the prediction of severity of preeclampsia. The study group comprised of 40 preeclamptic cases (22 with mild and 18 with severe) and 40 healthy normotensive pregnant controls. Serum samples of all the cases were assayed for GGT and LDH. Demographic, hemodynamic and laboratory data as well as serum GGT and LDH levels were compared among the three groups.
The results indicated that severe preeclamptic cases had significantly increased levels of serum GGT and LDH. The symptoms in severe preeclamptic women were significantly increased in patients with GGT > 70 IU/L and LDH >800 IU/L. Elevated levels of serum GGT and LDH can be used as biochemical markers which reflects the severity of preeclampsia and useful for the management of preeclampsia to decrease maternal and fetal morbidity and mortality.
Abstract: The adverse effects of Clindamycin (Clind.) /
Ibuprofen (Ibu.) combination on liver, kidney, blood elements and the
significances of antioxidants (N-acetylcysteine and Zinc) against
these effects were evaluated. The study includes: Group I; control
n=30, Group II; patients on Clind.300mg/Ibu.400mg twice daily for a
week n=30, Group III; patients on Clind.300mg/Ibu.400mg+Nacetylcysteine
200mg twice daily for a week n=15 and Group IV;
patients on Clind.300mg/Ibu.400mg+Zinc50mg twice daily for a
week n=15. Serum malondialdehyde (MDA), alanine transferase
(ALT), aspartate transferase (AST), γ glutamyl transferase (GGT),
creatinine, blood urea nitrogen (BUN) were measured. Applying one
way ANOVA followed by Tuckey Kramer post test, Group II showed
significant increase in ALT, AST, GGT, BUN and decrease in Hb,
RBCs, platelets than Group I. Group III showed significant decrease
in ALT, AST, GGT, BUN than Group II. Moreover, Group IV
showed significant decrease in ALT, AST, GGT and increase in Hb,
RBCs, and platelets than Group II. Conclusively, Adding Zinc or Nacetylcysteine
buffer the oxidative stress and improve the therapeutic
outcome of Clindamycin/Ibuprofen combination.
Abstract: Protective effect of ethanolic extract of polyherbal formulation (PHF) was studied on carbon tetrachloride induced liver damage on carbon tetrachloride induced liver damage. Treatment of rats with 250mg /kg body weight of ethanolic extract of PHF protected rats against carbon tetrachloride liver injury by significant lowerering 5’ nucleotidase (5’NT), Gamma Glutamyl transferase (GGT), Glutamate dehdyrogenasse (GDH) and Succinate Dehydrogenase (SDH) levels compared to control. Normalization in these enzyme levels indicates strong hepatoprotective property of PHF extract.
Abstract: Life is beautiful. But, it is decided by genes, environment and the individual and shattered by the natural and / or the invited problems. Most of the global rural helpless masses are struggling for their survival since; they are neglected in all aspects of life including health. Amidst a countless number of miserable diseases in man, diabetes is becoming a dreaded killer and ramifying the entire globe in a jet speed. Diabetes control continues as a Herculean task to the scientific community and the modern society in the 21st century also. T2DM is not pertaining to any age and it can develop even during the childhood. This multifactorial disease abruptly changes the activities of certain vital biomarkers in the present rural T2DM cases. A remarkable variation in the levels of biomarkers like AST, ALT, GGT, ALP, LDH, HbA1C, C- peptide, fasting sugar, post-prandial sugar, sodium, potassium, BUN, creatinine and insulin show the rampant nature of T2DM in this physically active rural agrarian community.