Abstract: Monoamine oxidase A gene (MAOA) is suggested to
be a candidate gene implicated in many neuropsychiatric disorders,
including autism spectrum disorder (ASD). This meta-analytic review
evaluates the relationship between ASD and MAOA markers such as
30 bp variable number tandem repeats in the promoter region
(uVNTR) and single nucleotide polymorphisms (SNPs) by using
findings from recently published studies. It seems that in Caucasian
males, the risk of developing ASD increase with the presence of 4-
repeat allele in the promoter region of MAOA gene whereas no
differences were found between autistic patients and controls in
Egyptian, West Bengal and Korean population. Some studies point to
the importance of specific haplotype groups of SNPs and interaction
of MAOA with others genes (e. g. FOXP2 or SRY). The results of
existing studies are insufficient and further research is needed.
Abstract: e-Service has moved from the usual manual and
traditional way of rendering services to electronic service provision
for the public and there are several reasons for implementing these
services, Airline ticketing have gone from its manual traditional way
to an intelligent web-driven service of purchasing. Many companies
have seen their profits doubled through the use of online services in
their operation and a typical example is Hewlett Packard (HP) which
is rapidly transforming their after sales business into a profit
generating e-service business unit.
This paper will examine the various challenges confronting e-
Service adoption and implementation in Nigeria and also analyse
lessons learnt from e-Service adoption and implementation in Asia to
see how it could be useful in Nigeria which is a lower middle income
country. From the analysis of the online survey data, it has been
identified that the public in Nigeria are much aware of e-Services but
successful adoption and implementation have been the problems
faced.
Abstract: Taro Scarab beetles (Papuana uninodis, Coleoptera:
Scarabaeidae) inflict severe damage on important root crops and
plants such as Taro or Cocoyam, yam, sweet potatoes, oil palm and
coffee tea plants across Africa and Asia resulting in economic
hardship and starvation in some nations. Scoliid wasps and
Metarhizium anisopliae fungus - bio-control agents; are shown to be
able to control the population of Scarab beetle adults and larvae using
a newly created simulation model based on non-linear ordinary
differential equations that track the populations of the beetle life
cycle stages: egg, larva, pupa, adult and the population of the scoliid
parasitoid wasps, which attack beetle larvae. In spite of the challenge
driven by the longevity of the scarab beetles, the combined effect of
the larval wasps and the fungal bio-control agent is able to control
and drive down the population of both the adult and the beetle eggs
below the environmental carrying capacity within an interval of 120
days, offering the long term prospect of a stable and eco-friendly
environment; where the population of scarab beetles is: regulated by
parasitoid wasps and beneficial soil saprophytes.
Abstract: Molluca Collision Zone is located at the junction of
the Eurasian, Australian, Pacific and the Philippines plates. Between
the Sangihe arc, west of the collision zone, and to the east of
Halmahera arc is active collision and convex toward the Molluca Sea.
This research will analyze the behavior of earthquake occurrence in
Molluca Collision Zone related to the distributions of an earthquake
in each partition regions, determining the type of distribution of a
occurrence earthquake of partition regions, and the mean occurence
of earthquakes each partition regions, and the correlation between the
partitions region. We calculate number of earthquakes using partition
method and its behavioral using conventional statistical methods. In
this research, we used data of shallow earthquakes type and its
magnitudes ≥4 SR (period 1964-2013). From the results, we can
classify partitioned regions based on the correlation into two classes:
strong and very strong. This classification can be used for early
warning system in disaster management.
Abstract: Students’ achievement and motivation in learning
English in Malaysia is a worrying trend as it is lagging behind several
other countries in Asia. Thus, necessary actions have to be taken by
the parties concerned to overcome this problem. The purpose of this
research was to study the effects of drill and practice courseware on
students’ achievement and motivation in learning English language.
A multimedia courseware was developed for this purpose. The
independent variable was the drill and practice courseware while the
dependent variables were the students’ achievement and motivation.
Their achievement was measured using pre-test and post-test scores,
while motivation was measured using a questionnaire. A total of 60
students from three vernacular primary schools in a northern state in
Malaysia were randomly selected in this study. The findings indicate:
(1) a significant difference between the students’ pre-test and posttest
scores after using the courseware, (2) no significant difference in
the achievement score between male and female students after using
the courseware, (3) a significant difference in motivation score
between the female and the male students, and (4) while the female
students scored significantly higher than the male students in the
aspects of relevance, confidence and satisfaction, no significant
difference in terms of attention was observed between them. Overall,
the findings clearly indicate that although the female students are
significantly more motivated than their male students, they are
equally good in terms of achievement after learning from the
courseware. Through this study, the drill and practice courseware is
proven to influence the students’ learning and motivation.
Abstract: FengShui, an old Chinese discipline, dates back to
more than 5000 years, is one of the design principles that aim at
creating habitable and sustainable spaces in harmony with nature by
systematizing data within its own structure. Having emerged from
Chinese mysticism and embodying elements of faith in its principles,
FengShui argues that the positive energy in the environment channels
human behavior and psychology. This argument is supported with the
thesis of quantum physics that ‘everything is made up of energy’ and
gains an important place.
In spaces where living and working take place with several
principles and systematized rules, FengShui promises a happier, more
peaceful and comfortable life by influencing human psychology, acts,
and soul as well as the professional and social life of the individual.
Observing these design properties in houses, workplaces, offices, the
environment, and daily life as a design paradigm is significant. In this
study, how FengShui, a Central Asian culture emanated from Chinese
mysticism, shapes design and how it is used as an element of
sustainable design will be explained.
Abstract: The aim of present study was to monitor the presence
of Trichodina sp. in Rainbow trout, Oncorhynchus mykiss collected
from various fish farms in the western provinces of Iran during
January, 2013- January, 2014. Out of 675 sampled fish 335, (49.16%)
were infested with Trichodina. The highest prevalence was observed
in the spring and winter followed by autumn and summer. In general,
the intensity of infection was low except in cases where outbreaks of
Trichodiniasis endangered the survival of fish in some ponds. In light
infestation Trichodina is usually present on gills, fins and skin of
apparently healthy fish. Clinical signs of Trichodiniasis only appear
on fish with heavy infections and cases of moderate ones that are
usually exposed to one or more stress factors including, rough
handling during transportation from ponds, overcrowdness,
malnutrition, high of free ammonia and low of oxygen concentration.
Clinical signs of Trichodiniasis in sampled fish were sluggish
movement, loss of appetite, black coloration, necrosis and ulcer on
different parts of the body, detached scales and excessive
accumulation of mucous in gill pouches. The most obvious
histopathological changes in diseased fish were sloughing of the
epidermal layer, aggregation of leucocytes and melanine-carrying
cells (between the dermis and hypodermis) and proliferative changes
including hyperplasia and hypertrophy of the epithelial lining cells of
gill filaments which resulted in fusion of secondary lamellae. Control
of Trichodiniasis, has been achieved by formalin bath treatment at a
concentration of 250 ppm for one hour.
Abstract: In the culture of Thailand, the Yak serve as a mediated
icon representing strength, power, and mystical protection not only
for the Buddha, but for population of worshipers. Originating from
the forests of China, the Yak continues to stand guard at the gates of
Buddhist temples. The Yak represents Thai culture in the hearts of
Thai people. This paper presents a qualitative study regarding the
curious mix of media, culture, and religion that projects the Yak of
Thailand as a larger than life message throughout the political,
cultural, and religious spheres. The gate guardians, or gods as they
are sometimes called, appear throughout the religious temples of
Asian cultures. However, the Asian cultures demonstrate differences
in artistic renditions (or presentations) of such sentinels. Thailand
gate guards (the Yak) stand in front of many Buddhist temples, and
these iconic figures display unique features with varied symbolic
significance. The temple (or wat), plays a vital role in every
community; and, for many people, Thailand’s temples are the
country’s most endearing sights. The authors applied folknography as
a methodology to illustrate the importance of the Thai Yak in serving
as meaningful icons that transcend not only time, but the culture,
religion, and mass media. The Yak represents mythical, religious,
artistic, cultural, and militaristic significance for the Thai people.
Data collection included interviews, focus groups, and natural
observations. This paper summarizes the perceptions of the Thai
people concerning their gate sentries and the relationship,
communication, connection, and the enduring respect that Thai
people hold for their guardians of the gates.
Abstract: Persea declinata (Bl.) Kosterm is a member of the
Lauraceae family, widely distributed in Southeast Asia. It is from the
same genus with avocado (Persea americana Mill), which is widely
consumed as food and for medicinal purposes. In the present study,
we examined the anticancer properties of Persea declinata (Bl.)
Kosterm bark methanolic crude extract (PDM). PDM exhibited a
potent antiproliferative effect in MCF-7 human breast cancer cells,
with an IC50 value of 16.68 .g/mL after 48h of treatment. We
observed that PDM caused cell cycle arrest and subsequent apoptosis
in MCF-7 cells, as exhibited by increased population at G0/G1 phase,
higher lactate dehydrogenase (LDH) release, and DNA
fragmentation. Mechanistic studies showed that PDM caused
significant elevation in ROS production, leading to perturbation of
mitochondrial membrane potential, cell permeability, and activation
of caspases-3/7. On the other hand, real-time PCR and Western blot
analysis showed that PDM treatment increased the expression of the
proapoptotic molecule, Bax, but decreased the expression of
prosurvival proteins, Bcl-2 and Bcl-xL, in a dose-dependent manner.
These findings imply that PDM could inhibit proliferation in MCF-7
cells via cell cycle arrest and apoptosis induction, indicating its
potential as a therapeutic agent worthy of further development.
Abstract: The Indian subcontinent is facing a massive challenge with regards to energy security in its member countries; to provide reliable electricity to facilitate development across various sectors of the economy and consequently achieve the developmental targets. The instability of the current precarious situation is observable in the frequent system failures and blackouts.
The deployment of interconnected electricity ‘Supergrid’ designed to carry huge quanta of power across the Indian sub-continent is proposed in this paper. Not only enabling energy security in the subcontinent it will also provide a platform for Renewable Energy Sources (RES) integration. This paper assesses the need and conditions for a Supergrid deployment and consequently proposes a meshed topology based on Voltage Source High Voltage Direct Current (VSC- HVDC) converters for the Supergrid modeling. Various control schemes for the control of voltage and power are utilized for the regulation of the network parameters. A 3 terminal Multi Terminal Direct Current (MTDC) network is used for the simulations.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This research aims to study on “ASEAN Citizenship in the Internationalization of Thai Higher Education.” The purposes of this research are (1) to examine the Thai academics and scholars defined in the concept of internationalization of higher education, (2) to know how Thailand tries to fulfill its internationalization on education goal, (3) to find out the advantages and disadvantages of Thailand hub for higher education in Asia. Sequential mixed methods, qualitative and quantitative research methods were utilized to gather the data collected. By using a qualitative method (individual interviews from key Thai administrators and educators in the international higher education sector), a quantitative method (survey) was utilized to draw upon and to elaborate the recurring themes present during the interviews. The study found that many aspects of Thai international higher education programs received heavy influence from both the American and European higher education systems. Thailand’s role and leadership in the creation and launch of the ASEAN Economic Community (AEC) by 2015 gives its unique context for its internationalization efforts. English is being designated as the language of all Thai international programs; its influence further strengthened being the current language of academia, international business, and the internet, having global influence.
Abstract: Media displays in public areas are becoming
increasingly pervasive—they are used in many settings, come in
different sizes, serve different purposes, and have varied degrees of
interactivity. In this paper, we aim to provide a survey of how these
displays, often named media façades, are used in the wild in a city in
China which is undergoing a rapid growth. This survey is intended to
raise greater awareness and discussion about the use and effect of
these displays in public areas. Through this survey, we have been
able to distill some lessons of what is good, bad, and ugly about some
current examples of media displays used in a city that is transitioning
into becoming a modern one and one that is located in one of the
fastest growing areas in Asia. With this research, we hope that we can
provide technology designers and architects with some general
principles that can help them integrate these types of technologies
into their architectural creations.
Abstract: The purpose of this study was to determine the significance of history of obesity for the development of childhood overweight and/or obesity. Accordingly, a systematic literature review of English-language studies published from 1980 to 2012 using the following data bases: MEDLINE, PsychINFO, Cochrane Database of Systematic Reviews, and Dissertation Abstracts International was conducted. The following terms were used in the search: pregnancy, overweight, obesity, family history, parents, childhood, risk factors. Eleven studies of family history and obesity conducted in Europe, Asia, North America, and South America met the inclusion criteria. A meta-analysis of these studies indicated that family history of obesity is a significant risk factor of overweight and /or obesity in offspring; risk for offspring overweight and/or obesity associated with family history varies depending of the family members included in the analysis; and when family history of obesity is present, the offspring are at greater risk for developing obesity or overweight. In addition, the results from moderator analyses suggest that part of the heterogeneity discovered between the studies can be explained by the region of world that the study occurred in and the age of the child at the time of weight assessment.
Abstract: This research presents the first comprehensive survey of congener profiles (7 indicator congeners) of polybrominated diphenyl ethers (PBDEs) in sediment samples covering ten sites in CauBay River, Vietnam. Chemical analyses were carried out in gas chromatography–mass spectrometry (GC–MS) for tri- to hepta- brominated congeners. Results pointed out a non-homogenous contamination of the sediment with ∑7 PBDE values ranging from 8.93 to 25.64ng g−1, reflecting moderate to low contamination closely in conformity to other Asian aquatic environments. The general order of decreasing congener contribution to the total load was: BDE 47 > 99 > 100 > 154, similar to the distribution pattern worldwide. PBDEs had rare risks in the sediment of studied area. However, due to the propensity of PBDEs to accumulate in various compartments of wildlife and human food webs, evaluation of biological tissues should be undertaken as a high priority.
Abstract: The purpose of this study was to determine the significance of maternal smoking for the development of childhood overweight and/or obesity. Accordingly, a systematic literature review of English-language studies published from 1980 to 2012 using the following data bases: MEDLINE, PsychINFO, Cochrane Database of Systematic Reviews, and Dissertation Abstracts International was conducted. The following terms were used in the search: pregnancy, overweight, obesity, smoking, parents, childhood, risk factors. Eighteen studies of maternal smoking during pregnancy and obesity conducted in Europe, Asia, North America, and South America met the inclusion criteria. A meta-analysis of these studies indicated that maternal smoking during pregnancy is a significant risk factor for overweight and obesity; mothers who smoke during pregnancy are at a greater risk for developing obesity or overweight; the quantity of cigarettes consumed by the mother during pregnancy influenced the odds of offspring overweight and/or obesity. In addition, the results from moderator analyses suggest that part of the heterogeneity discovered between the studies can be explained by the region of world that the study occurred in and the age of the child at the time of weight assessment.
Abstract: ICAM-2 (intercellular adhesion molecule 2) or CD102 (Cluster of Differentiation 102) is type I transmembrane glycoproteins, composing 2-9 immunoglobulin-like C2-type domains. ICAM-2 plays the particular role in immune response and cell surveillance. It is concerned in innate and specific immunity, cell survival signal, apoptosis, and anticancer. EST clone of ICAM-2, from P. gigas blood cell EST libraries, showed high identity to human ICAM-2 (92%) with conserve region of ICAM N-terminal domain and part of Ig superfamily. Gene and protein of ICAM-2 has been founded in mammals. This is the first report of ICAM-2 in fish
Abstract: This study applies a simple and powerful nonlinear unit root test to test the validity of long-run purchasing power parity (PPP)
in a sample of 10 East-Asian countries (i.e., China, Hong Kong, Indonesia, Japan, Korea, Malaysia, Philippines, Singapore, Taiwan and Thailand) over the period of March 1985 to September 2008. The empirical results indicate that PPP holds true for half of these 10 East-Asian countries under study, and the adjustment toward PPP is found to be nonlinear and in an asymmetric way.
Abstract: In this paper the kinematic parameters of a regular Flapping Micro Air Vehicle (FMAV) is investigated. The optimization is done using multi-objective Genetic algorithm method. It is shown that the maximum propulsive efficiency is occurred on the Strouhal number of 0.2-0.3 and foil-pitch amplitude of 15°-30°. Furthermore, increasing pitch amplitude with respect to power optimization increases the thrust slightly until pitch amplitude around 30°, and then the trust is increased notably with increasing of pitch amplitude. Additionally, the maximum mean thrust coefficient is computed of 2.67 and propulsive efficiency for this value is 42%. Based on the thrust optimization, the maximum propulsive efficiency is acquired 54% while the mean thrust coefficient is 2.18 at the same propulsive efficiency. Consequently, the maximum propulsive efficiency is obtained 77% and the appropriate Strouhal number, pitch amplitude and phase difference between heaving and pitching are calculated of 0.27, 31° and 77°, respectively.
Abstract: To improve the water quality of lakes and control algae blooms, the effects of Vallisneria asiatica which is one of aquatic plants spread over Lake Taihu, with different biomasses on the water quality and algae communities were researched. The results indicated that V. asiatica could control an excess of Microcystis spp. when the V. asiatica biomass was larger than 50g in the tank with 30L solution in the laboratory. Planktonic and epiphytic algae responded differently to V. asiatica. The presence of macrophyte V. asiatica in eutrophic waters has a positive effect on algae compositions because of different sensitivities of algae species to allelopathic substances released by macrophyte V. asiatica. That is, V. asiatica could inhibit the growth of Microcystis spp. effectively and was benefited to the diatom on the condition in the laboratory.