Abstract: The Indian subcontinent is facing a massive challenge with regards to energy security in its member countries; to provide reliable electricity to facilitate development across various sectors of the economy and consequently achieve the developmental targets. The instability of the current precarious situation is observable in the frequent system failures and blackouts.
The deployment of interconnected electricity ‘Supergrid’ designed to carry huge quanta of power across the Indian sub-continent is proposed in this paper. Not only enabling energy security in the subcontinent it will also provide a platform for Renewable Energy Sources (RES) integration. This paper assesses the need and conditions for a Supergrid deployment and consequently proposes a meshed topology based on Voltage Source High Voltage Direct Current (VSC- HVDC) converters for the Supergrid modeling. Various control schemes for the control of voltage and power are utilized for the regulation of the network parameters. A 3 terminal Multi Terminal Direct Current (MTDC) network is used for the simulations.
Abstract: This paper proposes a linear mixed model (LMM) with spatial effects to forecast rice and cassava yields in Thailand at the same time. A multivariate conditional autoregressive (MCAR) model is assumed to present the spatial effects. A Bayesian method is used for parameter estimation via Gibbs sampling Markov Chain Monte Carlo (MCMC). The model is applied to the rice and cassava yields monthly data which have been extracted from the Office of Agricultural Economics, Ministry of Agriculture and Cooperatives of Thailand. The results show that the proposed model has better performance in most provinces in both fitting part and validation part compared to the simple exponential smoothing and conditional auto regressive models (CAR) from our previous study.
Abstract: Analyzing brain signals of the patients suffering from the state of depression may lead to interesting observations in the signal parameters that is quite different from a normal control. The present study adopts two different methods: Time frequency domain and nonlinear method for the analysis of EEG signals acquired from depression patients and age and sex matched normal controls. The time frequency domain analysis is realized using wavelet entropy and approximate entropy is employed for the nonlinear method of analysis. The ability of the signal processing technique and the nonlinear method in differentiating the physiological aspects of the brain state are revealed using Wavelet entropy and Approximate entropy.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: Both knowledge economy and sustainable development are considered key dimensions in the policy action lines of many developed and developing countries. In this context, universities and other higher education institutes have a vital role in developing and sustaining wellbeing communities.
In this paper, the authors’ aim is to address the links between the concepts of innovation and entrepreneurial capacity and knowledge economy, and to utilize the approach of intellectual capital development in building a sustainable knowledge economy.
The paper will contribute to two discourses:
Developing a common understanding of the intersection aspects between the three concepts: Knowledge economy, Innovation and entrepreneurial system, and sustainable development.
Paving the road towards developing an integrated multidimensional framework for sustainable knowledge economy.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper presents feature level image fusion using Haar lifting wavelet transform. Feature fused is edge and boundary information, which is obtained using wavelet transform modulus maxima criteria. Simulation results show the superiority of the result as entropy, gradient, standard deviation are increased for fused image as compared to input images. The proposed methods have the advantages of simplicity of implementation, fast algorithm, perfect reconstruction, and reduced computational complexity. (Computational cost of Haar wavelet is very small as compared to other lifting wavelets.)
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: Hand grip strength has been utilized as an indicator to evaluate the motor ability of hands, responsible for performing multiple body functions. It is, however, difficult to evaluate other factors (other than hand muscular strength) utilizing the hand grip strength only. In this study, we analyzed the motor ability of hands using EMG and the hand grip strength, simultaneously in order to evaluate concentration, muscular strength reaction time, instantaneous muscular strength change, and agility in response to visual reaction. In results, the average time (and their standard deviations) of muscular strength reaction EMG signal and hand grip strength was found to be 209.6 ± 56.2 ms and 354.3 ± 54.6 ms, respectively. In addition, the onset time which represents acceleration time to reach 90% of maximum hand grip strength, was 382.9 ± 129.9 ms.
Abstract: In this paper, we propose an optimization technique
that can be used to optimize the placements of reference nodes and
improve the location determination performance for the multi-floor
building. The proposed technique is based on Simulated Annealing
algorithm (SA) and is called MSMR-M. The performance study in
this work is based on simulation. We compare other node-placement
techniques found in the literature with the optimal node-placement
solutions obtained from our optimization. The results show that using
the optimal node-placement obtained by our proposed technique can
improve the positioning error distances up to 20% better than those of
the other techniques. The proposed technique can provide an average
error distance within 1.42 meters.
Abstract: This paper presents a comparative study between two
neural network models namely General Regression Neural Network
(GRNN) and Back Propagation Neural Network (BPNN) are used
to estimate radial overcut produced during Electrical Discharge
Machining (EDM). Four input parameters have been employed:
discharge current (Ip), pulse on time (Ton), Duty fraction (Tau) and
discharge voltage (V). Recently, artificial intelligence techniques, as
it is emerged as an effective tool that could be used to replace
time consuming procedures in various scientific or engineering
applications, explicitly in prediction and estimation of the complex
and nonlinear process. The both networks are trained, and the
prediction results are tested with the unseen validation set of the
experiment and analysed. It is found that the performance of both the
networks are found to be in good agreement with average percentage
error less than 11% and the correlation coefficient obtained for the
validation data set for GRNN and BPNN is more than 91%. However,
it is much faster to train GRNN network than a BPNN and GRNN is
often more accurate than BPNN. GRNN requires more memory space
to store the model, GRNN features fast learning that does not require
an iterative procedure, and highly parallel structure. GRNN networks
are slower than multilayer perceptron networks at classifying new
cases.
Abstract: One of the main biomedical problem lies in detecting dependencies in semi structured data. Solution includes biomedical portal and algorithms (integral rating health criteria, multidimensional data visualization methods). Biomedical portal allows to process diagnostic and research data in parallel mode using Microsoft System Center 2012, Windows HPC Server cloud technologies. Service does not allow user to see internal calculations instead it provides practical interface. When data is sent for processing user may track status of task and will achieve results as soon as computation is completed. Service includes own algorithms and allows diagnosing and predicating medical cases. Approved methods are based on complex system entropy methods, algorithms for determining the energy patterns of development and trajectory models of biological systems and logical–probabilistic approach with the blurring of images.
Abstract: Indoor wireless localization systems have played an
important role to enhance context-aware services. Determining the
position of mobile objects in complex indoor environments, such as
those in multi-floor buildings, is very challenging problems. This
paper presents an effective floor estimation algorithm, which can
accurately determine the floor where mobile objects located. The
proposed algorithm is based on the confidence interval of the
summation of online Received Signal Strength (RSS) obtained from
the IEEE 802.15.4 Wireless Sensor Networks (WSN).We compare
the performance of the proposed algorithm with those of other floor
estimation algorithms in literature by conducting a real
implementation of WSN in our facility. The experimental results and
analysis showed that the proposed floor estimation algorithm
outperformed the other algorithms and provided highest percentage
of floor accuracy up to 100% with 95-percent confidence interval.
Abstract: This research paper aimed to find out how was the ethical climate in an organization and job performance satisfaction of employees affected employees’ engagement and commitment by using the case study of PTT Exploration and Production Public Company Limited, Thailand. The population of this research was 4,383 Thai employees of PTTEP, Thailand. From a total of 420 questionnaires sent out, 345 respondents replied. The statistics utilized was mean score and Multiple Regression Analysis. The findings revealed that the respondents had opinion towards ethical climate of their organization, job performance satisfaction and organization engagement and commitment at a high level. The test of hypothesis disclosed the determinant attributes of job performance satisfaction that affected the respondents’ overall level of organization engagement and commitment. The set of these determinant attributes consisted of employees’ responsibilities for duties, organization’s policies and practice, relationship with organization’s commanders, work security and stability, job description, career path and relationship with colleagues. These variables were able to predict the employees’ organization engagement and commitment at 50.6 percent.