Abstract: Today, the means of following the developments in
the area of science and technology is to keep up with the pace of the
advancements in this area. As is in every profession, apart from their
personal efforts, the training of teachers in the period after they start
their careers is only possible through in-service training. The aim of
the present study is to determine the views of Information
Technologies (IT) teachers regarding the in-service training courses
organized by the Ministry of National Education. In this study, in
which quantitative research methods and techniques were employed,
the views of 196 IT teachers were collected by using the “Views on
In-service Training” questionnaire developed by the authors of the
paper. Independent groups t-test was used to determine whether the
views of IT teachers regarding in-service training differed depending
on gender, age and professional seniority. One-way analysis of
variance (ANOVA) was used to investigate whether the views of IT
teachers regarding in-service training differed depending on the
number of in-service training courses they joined and the type of inservice
training course they wanted to take. According to the findings
obtained in the study, the views of IT teachers on in-service training
did not show a significant difference depending on gender and age,
whereas those views differed depending on professional seniority, the
number of in-service training courses they joined and the type of inservice
training course they wanted to take.
Abstract: In this study, a liquid phase microextraction by hollow fiber (HF-LPME) combined with high performance liquid chromatography-UV detector was applied to preconcentrate and determine trace levels of Cyproheptadine in human urine and plasma samples. Cyproheptadine was extracted from 10 mL alkaline aqueous solution (pH: 9.81) into an organic solvent (n-octnol) which was immobilized in the wall pores of a hollow fiber. Then was back-extracted into an acidified aqueous solution (pH: 2.59) located inside the lumen of the hollow fiber. This method is simple, efficient and cost-effective. It is based on pH gradient and differences between two aqueous phases. In order to optimize the HF-LPME some affecting parameters including the pH of donor and acceptor phases, the type of organic solvent, ionic strength, stirring rate, extraction time and temperature were studied and optimized. Under optimal conditions enrichment factor, limit of detection (LOD) and relative standard deviation (RSD(%), n=3) were up to 112, 15 μg.L−1 and 2.7, respectively.
Abstract: The aim of this study was to determine the antimicrobial effect of Helichrysum arenarium L. essential oil in "in-vitro" condition on the growth of seven microbial species including Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Saccharomyces cereviciae, Candida albicans, Aspergillus flavus and Aspergillus parasiticus using micro-dilution method. The minimum inhibitory concentration (MIC) and minimum bactericidal or fungicidal concentration (MBC, MFC) were determined for the essential oil at ten concentrations. Finally, the sensitivity of tested microbes to essential oil of H. arenarium was investigated. Results showed that Bacillus subtilis (MIC=781.25 and MBC=6250 µg/ml) was more resistance than two other bacterial species. Among the tested yeasts, Saccharomyces cereviciae (MIC=97.65 and MFC=781.25 µg/ml) was more sensitive than Candida albicans while among the fungal species, growth of Aspergillus parasiticus inhibited at lower concentration of oil than the Aspergillus flavus. The extracted essential oil exhibited the same MIC value in the liquid medium against all fungal strains (48.82 µg/ml), while different activity against A. flavus and A. parasiticus was observed in this medium with MFC values of 6250 and 390.625µg/ml, respectively. The results of the present study indicated that Helichrysum arenarium L essential oil had significant (P
Abstract: Each of the countries around the world has different
ways of management and many of them depend on people to
administrate their country. Thailand, for example, empowers the
sovereignty of Thai people under constitution; however, our Thai
voting system is not able to flow fast enough under the current
Political management system. The sovereignty of Thai people is
addressing this problem through representatives during current
elections, in order to set a new policy for the countries ideology to
change in the House and the Cabinet.
This is particularly important in a democracy to be developed
under our current political institution. The Organic Act on Political
Parties 2007 is the establishment we have today that is causing
confrontations within the establishment. There are many political
parties that will soon be abolished. Many political parties have
already been subsidized. This research study is to analyze the legal
problems with the political party establishment under the Organic Act
on Political Parties 2007.
This will focus on the freedom of each political establishment
compared to an effective political operation. Textbooks and academic
papers will be referenced from studies home and abroad.
The study revealed that Organic Act on Political Parties 2007 has
strict provisions on the political structure over the number of
members and the number of branches involved within political
parties system.
Such operations shall be completed within one year; but under the
existing laws the small parties are not able to participate with the
bigger parties. The cities are capable of fulfilling small political party
requirements but fail to become coalesced because the current laws
won't allow them to be united as one. It is important to allow all
independent political parties to join our current political structure.
Board members can’t help the smaller parties to become a large
organization under the existing Thai laws.
Creating a new establishment that functions efficiently throughout
all branches would be one solution to these legal problems between
all political parties. With this new operation, individual political
parties can participate with the bigger parties during elections. Until
current political institutions change their system to accommodate
public opinion, these current Thai laws will continue to be a problem
with all political parties in Thailand.
Abstract: The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.
Abstract: In this paper, we employ a directed hypergraph model
to investigate the extent to which environmental variability influences
the set of available biochemical reactions within a living cell.
Such an approach avoids the limitations of the usual complex
network formalism by allowing for the multilateral relationships (i.e.
connections involving more than two nodes) that naturally occur
within many biological processes. More specifically, we extend the
concept of network reciprocity to complex hyper-networks, thus
enabling us to characterise a network in terms of the existence
of mutual hyper-connections, which may be considered a proxy
for metabolic network complexity. To demonstrate these ideas, we
study 115 metabolic hyper-networks of bacteria, each of which
can be classified into one of 6 increasingly varied habitats.
In particular, we found that reciprocity increases significantly
with increased environmental variability, supporting the view that
organism adaptability leads to increased complexities in the resultant
biochemical networks.
Abstract: The work presented in this paper was performed for a workstation of an assembly section in a company that manufactures radio modules and air conditioning for cars. After performing a workstation analysis and a questionnaire to the operators it was possible to understand the need to investigate the risk of musculoskeletal disorders originated from both the handling of loads as the incorrect dimensioning of the workstation. Regarding the handling of loads the NIOSH Equation was used and it was verified that there was no risk of musculoskeletal disorders. As the operators expressed their lack of satisfaction regarding back pains due to posture adopted they were established the appropriate dimensions (to satisfy 97.5% of the population and using the table of anthropometric data of the Portuguese population) for the workstation and it was proposed the availability of a chair for the workers.
Abstract: As a developing country, The Kingdom of Saudi Arabia (KSA) needs to make the best possible use of its workforce for social and economic reasons. The workforce is diverse, calling for appropriate diversity management (DM). The thesis focuses on the banking sector in KSA. To date, there have been no studies on DM in the banking sector in this country. Many organizations have introduced specific policies and programmes to improve the recruitment, inclusion, promotion, and retention of diverse employees, in addition to the legal requirements existing in many countries. However, Western-centric models of DM may not be applicable, at least not in their entirety, in other regions.
The aim of the study is to devise a framework for understanding gender, age and disability DM in the banking sector in KSA in order to enhance DM in this sector. A sample of 24 managers, 2 from each of the 12 banks, was interviewed to obtain their views on DM in the banking sector in KSA. Thematic analysis was used to analyze the data. These themes were used to develop the questionnaire, which was administered to 10 managers in each of the 12 banks. After analysis of these data, and completion of the study, the research will make a theoretical contribution to the knowledge on DM and a practical contribution to the management of diversity in Saudi banks. This paper concerns a work in progress.
Abstract: Many organizations are opting to adopt Open Source Software (OSS) as it is the current trend to rely on each other rather than on companies (Software vendors). It is a clear shift from organizations to individuals, the concept being to rely on collective participation rather than companies/vendors.
The main objectives of this research are 1) to identify the current level of OSS usage in Sultan Qaboos University; 2) to identify the potential benefits of using OSS in educational institutes; 3) to identify the OSS applications that are most likely to be used within an educational institute; 4) to identify the existing and potential barriers to the successful adoption of OSS in education.
To achieve these objectives a two-stage research method was conducted. First a rigorous literature review of previously published material was performed (interpretive/descriptive approach), and then a set of interviews were conducted with the IT professionals at Sultan Qaboos University in Oman in order to explore the extent and nature of their usage of OSS.
Abstract: As an emerging business model, cloud computing has been initiated to satisfy the need of organizations and to push Information Technology as a utility. The shift to the cloud has changed the way Information Technology departments are managed traditionally and has raised many concerns for both, public and private sectors.
The purpose of this study is to investigate the possibility of cloud computing services replacing services provided traditionally by IT departments. Therefore, it aims to 1) explore whether organizations in Oman are ready to move to the cloud; 2) identify the deciding factors leading to the adoption or rejection of cloud computing services in Oman; and 3) provide two case studies, one for a successful Cloud provider and another for a successful adopter.
This paper is based on multiple research methods including conducting a set of interviews with cloud service providers and current cloud users in Oman; and collecting data using questionnaires from experts in the field and potential users of cloud services.
Despite the limitation of bandwidth capacity and Internet coverage offered in Oman that create a challenge in adopting the cloud, it was found that many information technology professionals are encouraged to move to the cloud while few are resistant to change.
The recent launch of a new Omani cloud service provider and the entrance of other international cloud service providers in the Omani market make this research extremely valuable as it aims to provide real-life experience as well as two case studies on the successful provision of cloud services and the successful adoption of these services.
Abstract: According to the scientific information management literature, the improper use of information technology (e.g. personal computers) by employees are one main cause for operational and information security loss events. Therefore, organizations implement information security awareness programs to increase employees’ awareness to further prevention of loss events. However, in many cases these information security awareness programs consist of conventional delivery methods like posters, leaflets, or internal messages to make employees aware of information security policies. We assume that a viral information security awareness video might be more effective medium than conventional methods commonly used by organizations. The purpose of this research is to develop a viral video artifact to improve employee security behavior concerning information technology.
Abstract: Wireless communications have been expanded very fast in recent decades. This technology relies on an extensive network of base stations and antennas, using radio frequency signals to transmit information. Devices that use wireless communication, while offering various services, basically act as sources of non-ionizing electromagnetic fields (EMF). Such devices are permanently present in human vicinity and almost constantly radiate, causing EMF pollution of the environment. This fact has initiated development of modern systems for observation of the EMF pollution, as well as for risk assessment. This paper presents the Serbian electromagnetic field monitoring network – SEMONT, designed for automated, remote and continuous broadband monitoring of EMF in the environment. Measurement results of the SEMONT monitoring at one of the test locations, within the main campus of the University of Novi Sad, are presented and discussed, along with corresponding exposure assessment of the general population, regarding the Serbian legislation.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: We present results from experimental price-setting oligopolies in which green firms undertake different levels of energy-saving investments motivated by public subsidies and demand-side advantages. We find that consumers reveal higher willingness to pay for greener sellers’ products. This observation in conjunction to the fact that greener sellers set higher prices is compatible with the use and interpretation of energy-saving behaviour as a differentiation strategy. However, sellers do not exploit the resulting advantage through sufficiently high price-cost margins, because they seem trapped into “run to stay still” competition. Regarding the use of public subsidies to energy-saving sellers we uncover an undesirable crowding-out effect of consumers’ intrinsic tendency to support green manufacturers. Namely, consumers may be less willing to support a green seller whose energy-saving strategy entails a direct financial benefit. Finally, we disentangle two alternative motivations for consumer’s attractions to pro-social firms; first, the self-interested recognition of the firm’s contribution to the public and private welfare and, second, the need to compensate a firm for the cost entailed in each pro-social action. Our results show the prevalence of the former over the latter.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: An investigation of adaptable winglets for morphing
aircraft control and performance is described in this paper. The
concepts investigated consist of various winglet configurations
fundamentally centred on a baseline swept wing. The impetus for the
work was to identify and optimize winglets to enhance controllability
and the aerodynamic efficiency of a small unmanned aerial vehicle.
All computations were performed with Athena Vortex Lattice
modelling with varying degrees of twist, swept, and dihedral angle
considered. The results from this work indicate that if adaptable
winglets were employed on small scale UAV’s improvements in both
aircraft control and performance could be achieved.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.
Abstract: This research paper aimed to find out how was the ethical climate in an organization and job performance satisfaction of employees affected employees’ engagement and commitment by using the case study of PTT Exploration and Production Public Company Limited, Thailand. The population of this research was 4,383 Thai employees of PTTEP, Thailand. From a total of 420 questionnaires sent out, 345 respondents replied. The statistics utilized was mean score and Multiple Regression Analysis. The findings revealed that the respondents had opinion towards ethical climate of their organization, job performance satisfaction and organization engagement and commitment at a high level. The test of hypothesis disclosed the determinant attributes of job performance satisfaction that affected the respondents’ overall level of organization engagement and commitment. The set of these determinant attributes consisted of employees’ responsibilities for duties, organization’s policies and practice, relationship with organization’s commanders, work security and stability, job description, career path and relationship with colleagues. These variables were able to predict the employees’ organization engagement and commitment at 50.6 percent.