Abstract: Analyzing brain signals of the patients suffering from the state of depression may lead to interesting observations in the signal parameters that is quite different from a normal control. The present study adopts two different methods: Time frequency domain and nonlinear method for the analysis of EEG signals acquired from depression patients and age and sex matched normal controls. The time frequency domain analysis is realized using wavelet entropy and approximate entropy is employed for the nonlinear method of analysis. The ability of the signal processing technique and the nonlinear method in differentiating the physiological aspects of the brain state are revealed using Wavelet entropy and Approximate entropy.
Abstract: High resolution seismic reflection has recently been carried out on Zaria batholith, with the aim of characterizing the granitic Zaria batholiths in terms of its lithology. The geology of the area has revealed that the older granite outcrops in the vicinity of Zaria are exposures of a syntectonics to late-tectonic granite batholiths which intruded a crystalline gneissic basement during the Pan-African Orogeny. During the data acquisition the geophone were placed at interval of 1 m, variable offset of 1 and 10 m was used. The common midpoint (CMP) method with 12 fold coverage was employed for the survey. Analysis of the generated 3D surface of the p wave velocities from different profiles for densities and bulk modulus revealed that the rock material is more consolidated in South East part of the batholith and less consolidated in the North Western part. This was in conformity with earlier identified geology of the area, with the South Eastern part majorly of granitic outcrop, while the North Western part is characterized with the exposure of gneisses and thick overburden cover. The difference in lithology was also confirmed by the difference in seismic sections and Arial satellite photograph. Hence two major lithologies were identified, the granitic and gneisses complex which are characterized by gradational boundaries.
Abstract: This work presents a comparison study between the state-space and polynomial methods for the design of the robust governor for load frequency control of steam turbine power systems. The robust governor is synthesized using the two approaches and the comparison is extended to include time and frequency domains performance, controller order, and uncertainty representation, weighting filters, optimality and sub-optimality. The obtained results are represented through tables and curves with reasons of similarities and dissimilarities.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: This study compared the mechanical and microstructural properties produced during friction stir welding (FSW) of S275 structural steel in air and underwater. Post weld tests assessed the tensile strength, micro-hardness, distortion, Charpy impact toughness and fatigue performance in each case. The study showed that there was no significant difference in the strength, hardness or fatigue life of the air and underwater specimens. However, Charpy impact toughness was shown to decrease for the underwater specimens and was attributed to a lower degree of recrystallization caused by the higher rate of heat loss experienced when welding underwater. Reduced angular and longitudinal distortion was observed in the underwater welded plate compared to the plate welded in air.
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: Outrigger-braced wall systems are commonly used to provide high rise buildings with the required lateral stiffness for wind and earthquake resistance. The existence of outriggers adds to the stiffness and strength of walls as reported by several studies. The effects of different parameters on the elasto-plastic dynamic behavior of outrigger-braced wall systems to earthquakes are investigated in this study. Parameters investigated include outrigger stiffness, concrete strength, and reinforcement arrangement as the main design parameters in wall design. In addition to being significantly affect the wall behavior, such parameters may lead to the change of failure mode and the delay of crack propagation and consequently failure as the wall is excited by earthquakes. Bi-linear stress-strain relation for concrete with limited tensile strength and truss members with bi-linear stress-strain relation for reinforcement were used in the finite element analysis of the problem. The famous earthquake record, El-Centro, 1940 is used in the study. Emphasize was given to the lateral drift, normal stresses and crack pattern as behavior controlling determinants. Results indicated significant effect of the studied parameters such that stiffer outrigger, higher grade concrete and concentrating the reinforcement at wall edges enhance the behavior of the system. Concrete stresses and cracking behavior are too much enhanced while less drift improvements are observed.
Abstract: In this paper a nonlinear feedback control called augmented automatic choosing control (AACC) for a class of
nonlinear systems with constrained input is presented. When designed
the control, a constant term which arises from linearization of a
given nonlinear system is treated as a coefficient of a stable zero
dynamics. Parameters of the control are suboptimally selected by
maximizing the stable region in the sense of Lyapunov with the aid
of a genetic algorithm. This approach is applied to a field excitation
control problem of power system to demonstrate the splendidness
of the AACC. Simulation results show that the new controller can
improve performance remarkably well.
Abstract: The design of an optimised horizontal axis 5-meter-long wind turbine rotor blade in according with IEC 61400-2 standard is a research and development project in order to fulfil the requirements of high efficiency of torque from wind production and to optimise the structural components to the lightest and strongest way possible. For this purpose, a research study is presented here by focusing on the structural characteristics of a composite wind turbine blade via finite element modelling and analysis tools. In this work, first, the required data regarding the general geometrical parts are gathered. Then, the airfoil geometries are created at various sections along the span of the blade by using CATIA software to obtain the two surfaces, namely; the suction and the pressure side of the blade in which there is a hat shaped fibre reinforced plastic spar beam, so-called chassis starting at 0.5m from the root of the blade and extends up to 4 m and filled with a foam core. The root part connecting the blade to the main rotor differential metallic hub having twelve hollow threaded studs is then modelled. The materials are assigned as two different types of glass fabrics, polymeric foam core material and the steel-balsa wood combination for the root connection parts. The glass fabrics are applied using hand wet lay-up lamination with epoxy resin as METYX L600E10C-0, is the unidirectional continuous fibres and METYX XL800E10F having a tri-axial architecture with fibres in the 0,+45,-45 degree orientations in a ratio of 2:1:1. Divinycell H45 is used as the polymeric foam. The finite element modelling of the blade is performed via MSC PATRAN software with various meshes created on each structural part considering shell type for all surface geometries, and lumped mass were added to simulate extra adhesive locations. For the static analysis, the boundary conditions are assigned as fixed at the root through aforementioned bolts, where for dynamic analysis both fixed-free and free-free boundary conditions are made. By also taking the mesh independency into account, MSC NASTRAN is used as a solver for both analyses. The static analysis aims the tip deflection of the blade under its own weight and the dynamic analysis comprises normal mode dynamic analysis performed in order to obtain the natural frequencies and corresponding mode shapes focusing the first five in and out-of-plane bending and the torsional modes of the blade. The analyses results of this study are then used as a benchmark prior to modal testing, where the experiments over the produced wind turbine rotor blade has approved the analytical calculations.
Abstract: This paper presents breast cancer detection by
observing the specific absorption rate (SAR) intensity for
identification tumor location, the tumor is identified in coordinates
(x,y,z) system. We examined the frequency between 4-8 GHz to look
for the most appropriate frequency. Results are simulated in
frequency 4-8 GHz, the model overview include normal breast with
50 mm radian, 5 mm diameter of tumor, and ultra wideband (UWB)
bowtie antenna. The models are created and simulated in CST
Microwave Studio. For this simulation, we changed antenna to 5
location around the breast, the tumor can be detected when an
antenna is close to the tumor location, which the coordinate of
maximum SAR is approximated the tumor location. For reliable, we
experiment by random tumor location to 3 position in the same size
of tumor and simulation the result again by varying the antenna
position in 5 position again, and it also detectable the tumor position
from the antenna that nearby tumor position by maximum value of
SAR, which it can be detected the tumor with precision in all
frequency between 4-8 GHz.
Abstract: This research investigates the distribution of food
demand for animal food and the optimum amount of that food
production at minimum cost. The data consist of customer purchase
orders for the food of laying hens, price of food for laying hens, cost
per unit for the food inventory, cost related to food of laying hens in
which the food is out of stock, such as fine, overtime, urgent
purchase for material. They were collected from January, 1990 to
December, 2013 from a factory in Nakhonratchasima province. The
collected data are analyzed in order to explore the distribution of the
monthly food demand for the laying hens and to see the rate of
inventory per unit. The results are used in a stochastic linear
programming model for aggregate planning in which the optimum
production or minimum cost could be obtained. Programming
algorithms in MATLAB and tools in Linprog software are used to get
the solution. The distribution of the food demand for laying hens and
the random numbers are used in the model. The study shows that the
distribution of monthly food demand for laying has a normal
distribution, the monthly average amount (unit: 30 kg) of production
from January to December. The minimum total cost average for 12
months is Baht 62,329,181.77. Therefore, the production planning
can reduce the cost by 14.64% from real cost.
Abstract: A new efficient normal parameter reduction algorithm of soft set in decision making was proposed. However, up to the present, few documents have focused on real-life applications of this algorithm. Accordingly, we apply a New Efficient Normal Parameter Reduction algorithm into real-life datasets of online shopping, such as Blackberry Mobile Phone Dataset. Experimental results show that this algorithm is not only suitable but feasible for dealing with the online shopping.
Abstract: The purpose of this research was to study the influence of accountants’ potential performance on their working process, a case study of Government Savings Banks in the northeast of Thailand. The independent variables included accounting knowledge, accounting skill, accounting value, accounting ethics, and accounting attitude, while the dependent variable included the success of the working process. A total of 155 accountants working for Government Savings Banks were selected by random sampling. A questionnaire was used as a tool for collecting data. Descriptive statistics in this research included percentage, mean, and multiple regression analyses.
The findings revealed that the majority of accountants were female with an age between 35-40 years old. Most of the respondents had an undergraduate degree with ten years of experience. Moreover, the factors of accounting knowledge, accounting skill, accounting a value and accounting ethics and accounting attitude were rated at a high level. The findings from regression analysis of observation data revealed a causal relationship in that the observation data could explain at least 51 percent of the success in the accountants’ working process.
Abstract: Recent growth in digital multimedia technologies has presented a lot of facilities in information transmission, reproduction and manipulation. Therefore, the concept of information security is one of the superior articles in the present day situation. The biometric information security is one of the information security mechanisms. It has the advantages as well as disadvantages. The biometric system is at risk to a range of attacks. These attacks are anticipated to bypass the security system or to suspend the normal functioning. Various hazards have been discovered while using biometric system. Proper use of steganography greatly reduces the risks in biometric systems from the hackers. Steganography is one of the fashionable information hiding technique. The goal of steganography is to hide information inside a cover medium like text, image, audio, video etc. through which it is not possible to detect the existence of the secret information. Here in this paper a new security concept has been established by making the system more secure with the help of steganography along with biometric security. Here the biometric information has been embedded to a skin tone portion of an image with the help of proposed steganographic technique.
Abstract: Generally, the traditional Shewhart p chart has been developed by for charting the binomial data. This chart has been developed using the normal approximation with condition as low defect level and the small to moderate sample size. In real applications, however, are away from these assumptions due to skewness in the exact distribution. In this paper, a modified Exponentially Weighted Moving Average (EWMA) control chat for detecting a change in binomial data by improving square root transformations, namely ISRT p EWMA control chart. The numerical results show that ISRT p EWMA chart is superior to ISRT p chart for small to moderate shifts, otherwise, the latter is better for large shifts.
Abstract: In this research, it is aimed not only microwave synthesis of magnesium borates but also evaluation of magnesium wastes. Synthesis process can be described with the reaction of Mg wastes and boric acid using microwave energy. X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) were applied to synthesized minerals. According to XRD results, magnesium borate hydrate mixtures were obtained as mcallisterite (pdf# = 01-070-1902, Mg2(B6O7(OH)6)2.9(H2O)) at higher crystallinity properties was achieved at the mole ratio raw material 1:1. Also, other kinds of magnesium borate hydrates were obtained at lower crystallinity such as admontite (pdf # = 01-076-0540, MgO(B2O3)3.7(H2O)), inderite (pdf # = 01-072-2308, 2MgO.3B2O3.15(H2O)) and magnesium borate hydrates (pdf # = 01-076-0539, MgO(B2O3)3.6(H2O)). FT-IR spectrums indicated that minor changes were seen at the band values of characteristic stretching in each experiment. At the end of experiments it is seen that using microwave energy may contribute positive effects to design of synthesis process such as reducing reaction time and products at higher crystallinity.
Abstract: The paper explores the cultural rights accommodation by the state which has left many unresolved problems. The cultural rights sometimes violate the basic individual rights of the members inside the community like women. The paper further explicates certain cultural norms and practices which violates the rights of women inside the community in the name of culture.
Abstract: Because of the outbreak of mad cow disease and bird flu, consumers have become more concerned with quality and safety of meat and poultry. As a consequence, meat traceability has been implemented as a tool to raise the standard in the meat production industry. In Thailand, while traceability is relatively common among the manufacturer-wholesaler-retailers cycle, it is rarely used as a marketing tool specifically designed to persuade consumers who are the actual meat endusers. Therefore, the present study attempts to understand what influences consumers to spread their words-of-mouth (WOM) regarding meat with traceability by conducting a study in Thailand where research in this area is rather scant. Data were collected from one hundred and sixty-seven consumers in the northeastern region and analyzed with SEM. The study results reveal that perceived usefulness of traceability system, social norms, and product class knowledge are significant antecedents where consumers spread positive words regarding meat with traceability system. A number of theoretical and managerial implications as well as future study directions are offered at the end of this study report.