A Study of the Influence of College Students’ Exercise and Leisure Motivations on the Leisure Benefits – Using Leisure Involvement as a Moderator

This study aim at the influence of college students’ exercise and leisure motivations on the leisure benefits while using the leisure involvement as a moderator. Whereby, the research tools used in this study included the application of leisure motivation scale, leisure involvement scale and leisure benefits scale, and a hierarchical regression analysis was performed by using a questionnaire-based survey, in which, a total of 1,500 copies of questionnaires were administered and 917 valid questionnaires were obtained, achieving a response rate of 61.13%. Research findings explore that leisure involvement has a moderating effect on the relationship between the leisure motivation and leisure benefits.

The Relevant Study of Leisure Motivation, Leisure Attitude and Health Promotion Lifestyle of Elderly People in Taiwan

The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.

Effect of Amine-Functionalized Carbon Nanotubes on the Properties of CNT-PAN Composite Nanofibers

PAN nanofibers reinforced with amine functionalized carbon nanotubes. The effect of amine functionalization and the effect of concentration of CNT on the conductivity and mechanical and morphological properties of composite nanofibers were examined. 1%CNT-NH2 loaded PAN/CNT nanofiber showed the best mechanical properties. Conductivity increased with the incorporation of carbon nanotubes. While an increase of concentration of CNT increases the diameter of nanofiber, the use of functionalized CNT results to decrease of diameter of nanofiber.

Alexandria’s Eastern Entrance: Analysis of Qaitbay Waterfront Development

Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts. This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence. Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.

Investigation of Electrical, Thermal and Structural Properties on Polyacrylonitrile Nano-Fiber

Polymer composite nano-fibers including (1, 3 wt %) silver nano-particles have been produced by electrospinning method. Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have been prepared and the amount of silver nitrate have been adjusted to PAN weight. Silver nano-particles were obtained from reduction of silver ions into silver nano-particles by chemical reduction by hydrazine hydroxide (N2H5OH). The different amount of silver salt was loaded into polymer matrix to obtain polyacrylonitrile composite nano-fiber containing silver nano-particles. The effect of the amount of silver nano-particles on the properties of composite nano-fiber web was investigated. Electrical conductivity, mechanical properties, thermal properties were examined by Microtest LCR Meter 6370 (0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter DSC (Q10) and SEM respectively. Also antimicrobial efficiency test (ASTM E2149-10) was done against to Staphylococcus aureus bacteria. It has been seen that breaking strength, conductivity, antimicrobial effect, enthalpy during cyclization increase by use of silver nano-particles while the diameter of nano-fiber decreases.

Characterization of Banana (Musa spp.) Pseudo-Stem and Fruit-Bunch-Stem as a Potential Renewable Energy Resource

Banana pseudo-stem and fruit-bunch-stem are agricultural residues that can be used for conversion to bio-char, biooil, and gases by using thermochemical process. The aim of this work is to characterize banana pseudo-stem and banana fruit-bunch-stem through proximate analysis, elemental analysis, chemical analysis, thermo-gravimetric analysis, and heating calorific value. The ash contents of the banana pseudo-stem and banana fruit-bunch-stem are 11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf wt.% respectively. The molecular formulas for banana stem and banana fruit-bunch-stem are C24H33NO26 and C19H29NO33 respectively. The measured higher heating values of banana pseudostem and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg respectively. By chemical analysis, the lignin, cellulose, and hemicellulose contents in the samples will also be presented. The feasibility of the banana wastes to be a feedstock for thermochemical process in comparison with other biomass will be discussed in this paper.

On The Design of Robust Governors of Steam Power Systems Using Polynomial and State-Space Based H∞ Techniques: A Comparative Study

This work presents a comparison study between the state-space and polynomial methods for the design of the robust governor for load frequency control of steam turbine power systems. The robust governor is synthesized using the two approaches and the comparison is extended to include time and frequency domains performance, controller order, and uncertainty representation, weighting filters, optimality and sub-optimality. The obtained results are represented through tables and curves with reasons of similarities and dissimilarities.

Influence of Seasons on Honeybee Wooden Hives Attack by Termites in Port Harcourt, Nigeria

Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.

Potentials of Raphia hookeri Wine in Livelihood Sustenance among Rural and Urban Populations in Nigeria

Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.

A Review: Comparative Study of Diverse Collection of Data Mining Tools

There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.

Metal-Based Anticancer Agents: In vitro DNA Binding, Cleavage and Cytotoxicity

Two new metal-based anticancer chemotherapeutic agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]- Cl.CH3OH.H2O 2, were designed, prepared and characterized by analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR) techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted octahedral and distorted trigonal-bipyramidal, respectively. Both 1 and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2 and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1 (2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible absorption studies suggest non-classical electrostatic mode of interaction via phosphate backbone of DNA double helix. The Stern- Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 × 106 M-1) determined by fluorescence studies suggests the groove binding and intercalation mode for 1 and 2, respectively. Effective cleavage of pBR322 DNA is induced by 1.Their interaction with DNA of cancer cells may account for potency.

Simulation of Die Casting Process in an Industrial Helical Gearbox Flange Die

Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.

Material Characterization and Numerical Simulation of a Rubber Bumper

Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.

A Review of Control Schemes for Active Power Filters in Order to Power Quality Improvement

Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.

The Impact of Training Method on Programming Learning Performance

Although several factors that affect learning to program have been identified over the years, there continues to be no indication of any consensus in understanding why some students learn to program easily and quickly while others have difficulty. Seldom have researchers considered the problem of how to help the students enhance the programming learning outcome. The research had been conducted at a high school in Taiwan. Students participating in the study consist of 330 tenth grade students enrolled in the Basic Computer Concepts course with the same instructor. Two types of training methods-instruction-oriented and exploration-oriented were conducted. The result of this research shows that the instruction-oriented training method has better learning performance than exploration-oriented training method.

Detection ofTensile Forces in Cable-Stayed Structures Using the Advanced Hybrid Micro-Genetic Algorithm

This study deals with an advanced numerical techniques to detect tensile forces in cable-stayed structures. The proposed method allows us not only to avoid the trap of minimum at initial searching stage but also to find their final solutions in better numerical efficiency. The validity of the technique is numerically verified using a set of dynamic data obtained from a simulation of the cable model modeled using the finite element method. The results indicate that the proposed method is computationally efficient in characterizing the tensile force variation for cable-stayed structures.

Ways of Life of Undergraduate Students Based On Sufficiency Economy Philosophy in Suan Sunandha Rajabhat University

This study aimed to analyse the application of sufficiency economy in students’ ways of life on campus at Suan Sunandha Rajabhat University. Data was gathered through 394 questionnaires. The study results found that the majority of students were confident that “where there’s a will, there’s a way.” Overall, the students applied the sufficiency economy at a great level, along with being persons who do not exploit others, were satisfied with living their lives moderately, according to the sufficiency economy. Importance was also given to kindness and generosity. Importantly, students were happy with living according to their individual circumstances and status at the present. They saw the importance of joint life planning, self-development, and self-dependence, always learning to be satisfied with “adequate”. As for their practices and ways of life, socially relational activities rated highly, especially initiation activities for underclassmen at the university and the seniority system, which are suitable for activities on campus. Furthermore, the students knew how to build a career and find supplemental income, knew how to earnestly work according to convention to finish work, and preferred to study elective subjects which directly benefit career-wise. The students’ application of sufficiency economy philosophy principles depended on their lives in their hometowns. The students from the provinces regularly applied sufficiency economy philosophy to their lives, for example, by being frugal, steadfast, determined, avoiding negligence, and making economical spending plans; more so than the students from the capital.

Case Study: Linking Career Education to University Education in Japan

Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.

Sustainability as a Criterion in the Reconstruction of Libya’s Public Transport Infrastructure

Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.