Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: High temperature is one of the most detrimental
effects that cause important changes in concrete’s mechanical,
physical, and thermo-physical properties. As a result of these
changes, especially high strength concrete (HSC), may exhibit
damages such as cracks and spallings. To overcome this problem,
incorporating polymer fibers such as polypropylene (PP) in concrete
is a very well-known method. In this study, using RRH, as a
sustainable material, instead of PP fiber in HSC to prevent spallings
and improve physical and thermo-physical properties were
investigated. Therefore, seven HSC mixtures with 0.25 water to
binder ratio were prepared incorporating silica fume and blast furnace
slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of
cement, respectively. All specimens were subjected to high
temperatures (20 (control), 300, 600 and 900˚C) with a heating rate
of 2.5˚C/min and after cooling, residual physical and thermo-physical
properties were determined.
Abstract: The copyrights system is a combination of different elements. The number, content and the correlation of these elements are different for different legal orders. The models of copyrights systems display this system in terms of the interaction of economic and author's moral rights. Monistic and dualistic models are the most popular ones. The article deals with different points of view on the monism and dualism in copyright system. A specific model of the copyright in Switzerland in the XXth century is analyzed. The evolution of a French dualistic model of copyright is shown. The author believes that one should talk not about one, but rather about a number of dualism forms of copyright system.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: This paper investigates the effect of simultaneous placement of DGs and smart meters (SMs), on voltage profile improvement in active distribution networks (ADNs). A substantial center of attention has recently been on responsive loads initiated in power system problem studies such as distributed generations (DGs). Existence of responsive loads in active distribution networks (ADNs) would have undeniable effect on sizing and siting of DGs. For this reason, an optimal framework is proposed for sizing and siting of DGs and SMs in ADNs. SMs are taken into consideration for the sake of successful implementing of demand response programs (DRPs) such as direct load control (DLC) with end-side consumers. Looking for voltage profile improvement, the optimization procedure is solved by genetic algorithm (GA) and tested on IEEE 33-bus distribution test system. Different scenarios with variations in the number of DG units, individual or simultaneous placing of DGs and SMs, and adaptive power factor (APF) mode for DGs to support reactive power have been established. The obtained results confirm the significant effect of DRPs and APF mode in determining the optimal size and site of DGs to be connected in ADN resulting to the improvement of voltage profile as well.
Abstract: In this paper we deal with using Lego Mindstorms in
simulation of robotic systems with respect to cost reduction. Lego
Mindstorms kit contains broad variety of hardware components
which are required to simulate, program and test the robotics systems
in practice. Algorithm programming went in development
environment supplied together with Lego kit as in programming
language C# as well. Algorithm following the line, which we dealt
with in this paper, uses theoretical findings from area of controlling
circuits. PID controller has been chosen as controlling circuit whose
individual components were experimentally adjusted for optimal
motion of robot tracking the line. Data which are determined to
process by algorithm are collected by sensors which scan the
interface between black and white surfaces followed by robot. Based
on discovered facts Lego Mindstorms can be considered for low-cost
and capable kit to simulate real robotics systems.
Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.
Abstract: Ultrasonic shot peening (USP) on AALY12 sheet was studied. Several parameters (arc heights, surface roughness, surface topography and micro hardness) with different USP process parameters were measured. The research proposes that radius of curvature of shot peened sheet increases with time and electric current decreasing, while increases with pin diameter increasing, and radius of curvature reaches a saturation level after a specific processing time and electric current. An empirical model of the relationship between radius of curvature and pin diameter, electric current, time was also obtained. The research shows that the increment of surface and vertical micro hardness of material is more obvious with longer time and higher value of electric current, which can be up to 20% and 28% respectively.
Abstract: We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.
Abstract: The purpose of this paper is to describe the main
characteristics of macroinvertebrate species in response to
environmental forcing factors. Overall, 23 species of Mollusca, 4
species of Arthropods, 3 species of Echinodermata and 3 species of
Annelida were identified at the 9 sampling stations during four
sampling periods. Individual species of Mollusca constituted 36.4%
of the total abundance, followed by Arthropods (27.01%), Annelida
(34.3%) and Echinodermata (2.4%). The results of Kruskal-Wallis
test indicated that a significant difference (p
Abstract: The aims of this research are to broaden the study on the relationship between emotional intelligence and counterproductive work behavior (CWB). The study sample consisted in 441 Romanian employees from companies all over the country. Data has been collected through web surveys and processed with SPSS. The results indicated an average correlation between the two constructs and their sub variables, employees with a high level of emotional intelligence tend to be less aggressive. In addition, labeling was considered an individual difference which has the power to influence the level of employee aggression. A regression model was used to underline the importance of emotional intelligence together with labeling as predictors of CWB. Results have shown that this regression model enforces the assumption that labeling and emotional intelligence, taken together, predict CWB. Employees, who label themselves as victims and have a low degree of emotional intelligence, have a higher level of CWB.
Abstract: The paper explores the cultural rights accommodation by the state which has left many unresolved problems. The cultural rights sometimes violate the basic individual rights of the members inside the community like women. The paper further explicates certain cultural norms and practices which violates the rights of women inside the community in the name of culture.
Abstract: In this paper, Semi-orthogonal B-spline scaling
functions and wavelets and their dual functions are presented
to approximate the solutions of integro-differential equations.The
B-spline scaling functions and wavelets, their properties and the
operational matrices of derivative for this function are presented to
reduce the solution of integro-differential equations to the solution of
algebraic equations. Here we compute B-spline scaling functions of
degree 4 and their dual, then we will show that by using them we have
better approximation results for the solution of integro-differential
equations in comparison with less degrees of scaling functions
Abstract: In this study, we investigated (In,Ga,Zn)Ox (IGZO) thin films and examined their characteristics of using Ga2O3-2 ZnO (GZO) co-sputtered In2O3 prepared by dual target radio frequency magnetron sputtering at room temperature in a pure Ar atmosphere. RF powers of 80 W and 70 W were used for GZO and pure In2O3, room temperature (RT) was used as deposition temperature, and the deposition time was changed from 15 min to 60 min. Structural, surface, electrical, and optical properties of IGZO thin films were investigated as a function of deposition time. Furthermore, the GZO co-sputtered In2O3 thin films showed a very smooth and featureless surface and an amorphous structure regardless of the deposition time due to the room temperature sputtering process. We would show that the co-sputtered IGZO thin films exhibited transparent electrode properties with high transmittance ratio and low resistivity.
Abstract: This paper proposes the development and design of
double layer metamaterials based on electromagnetic band gap
(EBG) rods as a superstrate of a resonator antenna to enhance
required antenna characteristics for the mobile base station. The
metallic rod type metamaterial can partially reflect wave of a primary
radiator. The antenna was designed and analyzed by a simulation
result from CST Microwave Studio and designed technique could be
confirmed by a measurement results from prototype antenna that
agree with simulation results. The results indicate that the antenna
can also generate a dual polarization by using a 45˚ oriented curved
strip dipole located at the center of the reflector plane with double
layer superstrate. It can be used to simplify the feed system of an
antenna. The proposed antenna has a bandwidth covering the
frequency range of 1920 – 2200 MHz, the gain of the antenna
increases up to 14.06 dBi. In addition, an interesting sectoral 60˚
pattern is presented in horizontal plane.
Abstract: This research was to analyze personality’s activities based on sufficiency economy philosophy of people and community leaders in urban communities. The data were collected through questionnaires administered to 392 people and interviewed with community leaders. It was found that most people revealed that their lives depend on activities in accordance with the sufficiency economy philosophy in high level especially, being honest and aware on sufficiency, occupations, peacefulness in the community leaders’ side, they reported on extravagant reduction, planting home vegetable garden, having household accounting, expense planning by dividing into 3 categories; 1) saving for illness cover 2) saving for business cover, and 3) household daily expense. The samples were also adjusted their livings quite well with the rapid change of urbanization. Although those people have encountered with any hardships, their honesty in occupations and awareness on sufficiency remain to survive happily.
Abstract: This research aims to study on “ASEAN Citizenship in the Internationalization of Thai Higher Education.” The purposes of this research are (1) to examine the Thai academics and scholars defined in the concept of internationalization of higher education, (2) to know how Thailand tries to fulfill its internationalization on education goal, (3) to find out the advantages and disadvantages of Thailand hub for higher education in Asia. Sequential mixed methods, qualitative and quantitative research methods were utilized to gather the data collected. By using a qualitative method (individual interviews from key Thai administrators and educators in the international higher education sector), a quantitative method (survey) was utilized to draw upon and to elaborate the recurring themes present during the interviews. The study found that many aspects of Thai international higher education programs received heavy influence from both the American and European higher education systems. Thailand’s role and leadership in the creation and launch of the ASEAN Economic Community (AEC) by 2015 gives its unique context for its internationalization efforts. English is being designated as the language of all Thai international programs; its influence further strengthened being the current language of academia, international business, and the internet, having global influence.
Abstract: Cognitive symptoms and behavioral symptoms may, in fact, overlap and be related to the level of the general cognitive function. We have measured the behavioral aspects of autism and its correlation to the cognitive ability in 30 children with ASD. We used a neuropsychological Battery CANTAB eclipse to evaluate the ASD children's cognitive ability. Individuals with ASD and challenging behaviors showed significant correlation between some cognitive abilities and Motor aspects. Based on these findings, we can conclude that the motor behavioral problems in autism affect specific cognitive abilities in ASDs such as comprehension, learning, reversal, acquisition, attention set shifting, and speed of reaction to one stimulus. Future researches should also focus on the relationship between motor stereotypes and other subtypes of repetitive behaviors, such as verbal stereotypes, ritual routine adherence, and the use of different types of CANTAB tests.
Abstract: Lexical invariants, being a sort of stereotypes within the frames of ordinary consciousness, are created by the members of a language community as a result of uniform division of reality. The invariant meaning is formed in person’s mind gradually in the course of different actualizations of secondary meanings in various contexts. We understand lexical the invariant as abstract language essence containing a set of semantic components. In one of its configurations it is the basis or all or a number of the meanings making up the semantic structure of the word.
Abstract: We present a deterministic model which describes
the dynamics of tuberculosis in Algerian population where the
vaccination program with BCG is in place since 1969 and where
the WHO recommendations regarding the DOTS (directly-observed
treatment, short course) strategy are in application. The impact
of an intervention program, targeting recently infected people
among all close contacts of active cases and their treatment to
prevent endogenous reactivation, on the incidence of tuberculosis,
is investigated. We showed that a widespread treatment of latently
infected individuals for some years is recommended to shift from
higher to lower equilibrium state and thereafter relaxation is
recommended.