Abstract: Sustainable tall buildings that provide comfortable,
healthy and efficient indoor environments are clearly desirable as the
densification of living and working space for the world’s increasing
population proceeds. For environmental concerns, these buildings
must also be energy efficient. One component of these tasks is the
provision of indoor air quality and thermal comfort, which can be
enhanced with natural ventilation by the supply of fresh air. Working
spaces can only be naturally ventilated with connections to the
outdoors utilizing operable windows, double facades, ventilation
stacks, balconies, patios, terraces and skygardens. Large amounts of
fresh air can be provided to the indoor spaces without mechanical
air-conditioning systems, which are widely employed in
contemporary tall buildings.
This paper tends to present the concept of natural ventilation for
sustainable tall office buildings in order to achieve healthy and
comfortable working spaces, as well as energy efficient
environments. Initially the historical evolution of ventilation
strategies for tall buildings is presented, beginning with natural
ventilation and continuing with the introduction of mechanical airconditioning
systems. Then the emergence of natural ventilation due
to the health and environmental concerns in tall buildings is handled,
and the strategies for implementing this strategy are revealed. In the
next section, a number of case studies that utilize this strategy are
investigated. Finally, how tall office buildings can benefit from this
strategy is discussed.
Abstract: Sustainability, being the urgent issue of our time, is
closely related with the innovations in technology. Nanotechnology
(NT), although not a new science, can be regarded relatively a new
science for buildings with brand new materials and applications. This
paper tends to give a research review of current and near future
applications of nanotechnology (NT) for achieving high-performance
and healthy buildings for a sustainable future. In the introduction, the
driving forces for the sustainability of construction industry are
explained. Then, the term NT is defined, and significance of
innovations in NT for a sustainable construction industry is revealed.
After presenting the application areas of NT and nanomaterials for
buildings with a number of cases, challenges in the adoption of this
technology are put forward, and finally the impacts of nanoparticles
and nanomaterials on human health and environment are discussed.
Abstract: Compost can influence soil fertility and plant health. At the same time compost can play an important role in the nitrogen cycle and it can influence leaching of mineral nitrogen from soil to underground water.
This paper deals with the influence of compost addition and mineral nitrogen fertilizer on leaching of mineral nitrogen, nitrogen availability in microbial biomass and plant biomass production in the lysimetric experiment. Twenty one lysimeters were filed with topsoil and subsoil collected in the area of protection zone of underground source of drinking water - Březová nad Svitavou. The highest leaching of mineral nitrogen was detected in the variant fertilized only mineral nitrogen fertilizer (624.58 mg m-2), the lowest leaching was recorded in the variant with high addition of compost (315.51 mg m-2). On the other hand, losses of mineral nitrogen are not in connection with the losses of available form of nitrogen in microbial biomass. Because lost of mineral nitrogen was detected in variant with the least change in the availability of N in microbial biomass.
The leaching of mineral nitrogen, yields as well as the results concerning nitrogen availability from the first year of long term experiment suggest that compost can positive influence the leaching of nitrogen into underground water.
Abstract: The Ballast Water Convention requires less than 5% of the world tonnage for ratification. Consequently, ships will have to comply with the requirements. Compliance evaluation and enforcement will become mandatory. Ship owners have to invest in treatment systems and shipboard personnel have to operate them and ensure compliance. The monitoring and enforcement will be the responsibilities of the Administrations. Herein, a review of the current status of the Ballast Water Management and the issues faced by these are projected. Issues range from efficacy and economics of the treatment systems to sampling and testing. Health issues of chemical systems, paucity of data for decision support etc., are other issues. It is emphasized that management of ballast water must be extended to ashore and sustainable solutions must be researched upon. An exemplar treatment system based on ship’s waste heat is also suggested.
Abstract: The case study presents the progression of a project management of Al-Shifa, a healthcare information system in Oman. The case study describes the evolution of the implementation of a healthcare information system tailored to meet the needs of the healthcare units under the supervision of the Ministry of Health (MOH) in Oman. A focus group methodology was used for collecting the relevant information from the main project's stakeholders. In addition reports about the project made available for the researchers. The case analysis is made based on the Project Management approach developed by the Project Management Institute (PMI). The main finding that there was no formal project management approach adopted by the MOH for the development and implementation of the herewith mentioned healthcare information system project. Furthermore, the project had suffered a scope creep in terms of features, cost and time-schedule. The recommendations of the authors, for the rescue of the project from its current dilemma, consist of technological, administrative and human resources development actions.
Abstract: Background: The high prevalence of obesity in Egypt has a great impact on the health care system, economic and social situation. Evidence suggests that even a moderate amount of weight loss can be useful. Aim of the study: To analyze the effects of lower body positive pressure supported treadmill training, conducted with hypocaloric diet, on body composition of obese children. Methods: Thirty children aged between 8 and 14 years, were randomly assigned into two groups: intervention group (15 children) and control group (15 children). All of them were evaluated using body composition analysis through bioelectric impedance. The following parameters were measured before and after the intervention: body mass, body fat mass, muscle mass, body mass index (BMI), percentage of body fat and basal metabolic rate (BMR). The study group exercised with antigravity treadmill three times a week during 2 months, and participated in a hypocaloric diet program. The control group participated in a hypocaloric diet program only. Results: Both groups showed significant reduction in body mass, body fat mass and BMI. Only study group showed significant reduction in percentage of body fat (p = 0.0.043). Changes in muscle mass and BMR didn't reach statistical significance in both groups. No significant differences were observed between groups except for muscle mass (p = 0.049) and BMR (p = 0.042) favoring study group. Conclusion: Both programs proved effective in the reduction of obesity indicators, but lower body positive pressure supported treadmill training was more effective in improving muscle mass and BMR.
Abstract: In this paper, the comparison between k-Nearest Neighbor (kNN) algorithms for classifying the 3D EEG model in brain balancing is presented. The EEG signal recording was conducted on 51 healthy subjects. Development of 3D EEG models involves pre-processing of raw EEG signals and construction of spectrogram images. Then, maximum PSD values were extracted as features from the model. There are three indexes for balanced brain; index 3, index 4 and index 5. There are significant different of the EEG signals due to the brain balancing index (BBI). Alpha-α (8–13 Hz) and beta-β (13–30 Hz) were used as input signals for the classification model. The k-NN classification result is 88.46% accuracy. These results proved that k-NN can be used in order to predict the brain balancing application.
Abstract: The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.
Abstract: This paper proposes a GLMM with spatial and
temporal effects for malaria data in Thailand. A Bayesian method is
used for parameter estimation via Gibbs sampling MCMC. A
conditional autoregressive (CAR) model is assumed to present the
spatial effects. The temporal correlation is presented through the
covariance matrix of the random effects. The malaria quarterly data
have been extracted from the Bureau of Epidemiology, Ministry of
Public Health of Thailand. The factors considered are rainfall and
temperature. The result shows that rainfall and temperature are
positively related to the malaria morbidity rate. The posterior means
of the estimated morbidity rates are used to construct the malaria
maps. The top 5 highest morbidity rates (per 100,000 population) are
in Trat (Q3, 111.70), Chiang Mai (Q3, 104.70), Narathiwat (Q4,
97.69), Chiang Mai (Q2, 88.51), and Chanthaburi (Q3, 86.82).
According to the DIC criterion, the proposed model has a better
performance than the GLMM with spatial effects but without
temporal terms.
Abstract: One of the main biomedical problem lies in detecting dependencies in semi structured data. Solution includes biomedical portal and algorithms (integral rating health criteria, multidimensional data visualization methods). Biomedical portal allows to process diagnostic and research data in parallel mode using Microsoft System Center 2012, Windows HPC Server cloud technologies. Service does not allow user to see internal calculations instead it provides practical interface. When data is sent for processing user may track status of task and will achieve results as soon as computation is completed. Service includes own algorithms and allows diagnosing and predicating medical cases. Approved methods are based on complex system entropy methods, algorithms for determining the energy patterns of development and trajectory models of biological systems and logical–probabilistic approach with the blurring of images.
Abstract: This article presents a monitoring indicators system
that predicts whether a local government in Taiwan is heading for
fiscal distress and identifies a suitable fiscal policy that would allow
the local government to achieve fiscal balance in the long run. This
system is relevant to stockholders’ interest, simple for national audit
bodies to use, and provides an early warning of fiscal distress that
allows preventative action to be taken.
Abstract: This research aims to create a knowledge-based system as a database for self-healthcare analysis, diagnosis of simple illnesses, and the use of Thai herbs instead of modern medicine by using principles of Thai traditional medication theory. These were disseminated by website network programs within Suan Sunandha Rajabhat University. The population used in this study was divided into two groups: the first group consisted of four experts of Thai traditional medication and the second group was 300 website users. The methods used for collecting data were paper questionnaires and poll questionnaires on the website. The statistics used for analyzing data was at an average level. The results were divided into three parts: the first part was the development of a knowledge-based system and the second part was applied programs on website. Both parts could be fulfilled and achieved according to the set goal. The third part was the evaluation of the study: The evaluation of the viewpoints of the experts towards website designs were evaluated at a good level of 4.20. The satisfaction evaluation of the users was found at a good level of average satisfactory level at 4.24. It was found that the young population of those under the age of 16 had less cares about their health than the population of other teenagers, working age adults and those of older age. The research findings should be extended in order to encourage the lifestyle modifications to people of all ages by using the self-healthcare principles.
Abstract: Diverse contaminants released into the environment through progress of urbanization and industrialization adversely affect human health. Among various sources of contaminants, especially, in big cities, automobiles play a significant role in aggravating the pollution. Various pollutants viz., heavy metals (Pb, Mn, Ni, Zn, As, Hg, Cd) and Polyaromatic hydrocarbons (Benzo-a-pyrene, fluoranthene, pyrene, benzo-b-anthracene, benzo-b-fluoranthene, acenaphthylene, fluorine, phenantherene, anthracene, chrysene, benzo-k-fluoranthene, benzo-e-pyrene, indenol-1,2,3-cd-pyrene, dibenzo-a,h-anthracene, benzo-ghi-perylene) are released by vehicles. Further, these pollutants are expected to cause severe mutagenic, genotoxic and carcinogenic effects. Considering this, many authors monitored the levels of pollution in roadside soil, water and plants. The present review focuses upon the analysis and effects of heavy metals and polycyclic aromatic hydrocarbons from the roadside samples.
Abstract: The purpose of the study was to examine the
relationships between objectively measured physical activity levels
(PALs), enjoyment of physical activity (EPA), and body mass index
(BMI) among adolescents. A total of 188 12-14-year-old Bruneian
secondary school adolescents (88 boys and 100 girls) voluntarily took
part in this study. Subjects wore the RT3 accelerometer for seven
consecutive days in order to measure their PALs. Times of students’
engagement in total (TPA), light (LPA), moderate (MPV), and
vigorous PA (VPA) were obtained from the accelerometer. Their
BMIs were calculated from their body height and weight. Physical
Activity Enjoyment Scale (PACES) was administrated to obtain their
EPA levels. Four key enjoyment factors including fun factors,
positive perceptions, unexciting in doing activities, and negative
perceptions were identified. Subjects’ social economic status (SES)
was provided by school administration. Results show that all the
adolescents did not meet the recommended PA guidelines even
though boys were engaged in more MVPA than girls. No
relationships were found between BMI and all PALs in both boys and
girls. BMI was significantly related to the PACES scores (r = -.22, p
= 0.01), fun factors (r = -.20, p = 0.05) and positive perceptions (r =-
.21, p < 0.05). The PACES scores were significantly related to LPA
(r = .18, p = 0.01) but not related to MVPA (r = .04, p > 0.05). After
controlling for age and SES, BMI was only significantly related to
the PACES scores in girls (r = -.27, p < .01) but boys (r = -.06, p >
0.05). Fun factors were significantly related to LPA and MVPA (p
Abstract: Nowadays harmonization of sanitary and hygienic standards of environmental quality with international standards is crucial part of integration of Russia into the international community. Harmonization of Russian and international ambient air quality standards may be realized by risk-based standards development. In this paper approaches to risk-based standards development and examples of these approaches implementation are presented.
Abstract: After the first acquaintance with internet in April 1993, number of internet users increased rapidly in Turkey. Almost half of the population between 16-74 age group use internet in the country. Hospitals are one of the areas where the internet is intensively being used like many other businesses. As a part of public relations application, websites are important tools for hospitals to reach a wide range of target audience within and outside the organization. With their websites, hospitals have opportunities to give information about their organization, strengthen their image, compete with their rivals, interact with shareholders, reflect their transparency and meet with new audiences. This study examines web sites of totally 34 hospitals which are located in Konya. Institutions are categorized as public and private hospitals and then three main research categories are determined: content, visual and technical. Main and sub categories are examined by using content analysis method. Results are interpreted in scope of public and private institutions and as a whole.
Abstract: Soil is a complex physical and biological system that provides support, water, nutrients and oxygen to the plants. Apart from these, it acts as a connecting link between inorganic, organic and living components of the ecosystem. In recent years, presence of xenobiotics, alterations in the natural soil environment, application of pesticides/inorganic fertilizers, percolation of contaminated surface water as well as leachates from landfills to subsurface strata and direct discharge of industrial wastes to the land have resulted in soil pollution which in turn has posed severe threats to human health especially in terms of causing carcinogenicity by direct DNA damage. The present review is an attempt to summarize literature on sources of soil pollution, characterization of pollutants and their consequences in different living systems.
Abstract: The objectives of this study (baseline study, n = 20) were to implement Matlab procedures for quantifying selected static balance variables, establish baseline data of selected variables which characterize static balance activities in a population of healthy young adult males, and to examine any trial effects on these variables. The results indicated that the implementation of Matlab procedures for quantifying selected static balance variables was practical and enabled baseline data to be established for selected variables. There was no significant trial effect. Recommendations were made for suitable tests to be used in later studies. Specifically it was found that one foot-tiptoes tests either in static balance is too challenging for most participants in normal circumstances. A one foot-flat eyes open test was considered to be representative and challenging for static balance.