Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.
Abstract: PAN nanofibers reinforced with amine functionalized
carbon nanotubes. The effect of amine functionalization and the
effect of concentration of CNT on the conductivity and mechanical
and morphological properties of composite nanofibers were
examined. 1%CNT-NH2 loaded PAN/CNT nanofiber showed the best
mechanical properties. Conductivity increased with the incorporation
of carbon nanotubes. While an increase of concentration of CNT
increases the diameter of nanofiber, the use of functionalized CNT
results to decrease of diameter of nanofiber.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Polymer composite nano-fibers including (1, 3 wt %)
silver nano-particles have been produced by electrospinning method.
Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have
been prepared and the amount of silver nitrate have been adjusted to
PAN weight. Silver nano-particles were obtained from reduction of
silver ions into silver nano-particles by chemical reduction by
hydrazine hydroxide (N2H5OH). The different amount of silver salt
was loaded into polymer matrix to obtain polyacrylonitrile composite
nano-fiber containing silver nano-particles. The effect of the amount
of silver nano-particles on the properties of composite nano-fiber web
was investigated. Electrical conductivity, mechanical properties,
thermal properties were examined by Microtest LCR Meter 6370
(0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter
DSC (Q10) and SEM respectively. Also antimicrobial efficiency test
(ASTM E2149-10) was done against to Staphylococcus aureus
bacteria. It has been seen that breaking strength, conductivity,
antimicrobial effect, enthalpy during cyclization increase by use of
silver nano-particles while the diameter of nano-fiber decreases.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.
Abstract: In this paper, we present a neural-network (NN) based
approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A
linear differential inclusion (LDI) state-space representation is utilized
to deal with the NN models. Taking advantage of the LDI
representation, the stability conditions and controller design are
derived for a class of nonlinear structural systems. Moreover, the
concept of utilizing the Parallel Particle Swarm Optimization (PPSO)
algorithm to solve the common P matrix under the stability criteria is
given in this paper.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.