On Pooling Different Levels of Data in Estimating Parameters of Continuous Meta-Analysis

A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.

Analysis of Entrepreneurship in Industrial Cluster

Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.

An AFM Approach of RBC Micro and Nanoscale Topographic Features during Storage

Blood gamma irradiation is the only available method to prevent transfusion associated graft versus host disease (TAGVHD). However, when blood is irradiated, determine blood shelf time is crucial. Non irradiated blood have a self-time from 21 to 35 days when is preserved with anticoagulated solution and stored at 4°C. During their storage, red blood cells (RBC) undergo a series of biochemical, biomechanical and molecular changes involving what is known as storage lesion (SL). SL include loss of structural integrity of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and increase of both ion potassium concentration and hemoglobin (Hb). On the other hand, Atomic force Microscopy (AFM) represents a versatile tool for a nano-scale high resolution topographic analysis in biological systems. In order to evaluate SL in irradiated and nonirradiated blood, RBC topography and morphometric parameters were obtained from an AFM XE-BIO system. Cell viability was followed using flow cytometry. Our results showed that early markers as nanoscale roughness, allow us to evaluate blood quality since other perspective.

The Relevant Study of Leisure Motivation, Leisure Attitude and Health Promotion Lifestyle of Elderly People in Taiwan

The purpose of this study was to investigate the relationships among leisure motivation, leisure attitude, and health promotion lifestyle. The participants were recruited from a convenience sampling that subjects were at least 55 years of age in Tainan City, Taiwan. Three hundred survey instruments were distributed, and 227 effective instruments were returned, for an effective rate of 75.7%. The collected data were analyzed statistically. The findings of this research were as follows: 1.There is significantly correlated between leisure motivation and leisure attitude. 2. There is significantly correlated between leisure attitude and health promotion lifestyle. 3. There is significantly correlated between leisure motivation and health promotion lifestyle.

Investigation of Electrical, Thermal and Structural Properties on Polyacrylonitrile Nano-Fiber

Polymer composite nano-fibers including (1, 3 wt %) silver nano-particles have been produced by electrospinning method. Polyacrylonitrile/N,N-dimethylformamide (PAN/DMF) solution have been prepared and the amount of silver nitrate have been adjusted to PAN weight. Silver nano-particles were obtained from reduction of silver ions into silver nano-particles by chemical reduction by hydrazine hydroxide (N2H5OH). The different amount of silver salt was loaded into polymer matrix to obtain polyacrylonitrile composite nano-fiber containing silver nano-particles. The effect of the amount of silver nano-particles on the properties of composite nano-fiber web was investigated. Electrical conductivity, mechanical properties, thermal properties were examined by Microtest LCR Meter 6370 (0.01 mΩ-100 MΩ), Tensile tester, Differential scanning calorimeter DSC (Q10) and SEM respectively. Also antimicrobial efficiency test (ASTM E2149-10) was done against to Staphylococcus aureus bacteria. It has been seen that breaking strength, conductivity, antimicrobial effect, enthalpy during cyclization increase by use of silver nano-particles while the diameter of nano-fiber decreases.

Influence of Seasons on Honeybee Wooden Hives Attack by Termites in Port Harcourt, Nigeria

Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.

Advertising Appeals and Cultural Values in Social Media Commercials in UK, Brasil and India: Case Study of Nokia and Samsung

The objectives of this study is to investigate the impact of culture on advertising appeals in mobile phone industry via social media channel in UK, Brazil and India. Content analysis on Samsung and Nokia commercials in YouTube is conducted. The result indicates that the advertising appeals are both congruent and incongruent with cultural dimensions in UK, Brazil and India. The result suggests that Hofstede and value paradoxes might be the tools to predict the relationship between cultural values and advertising appeals.

Potentials of Raphia hookeri Wine in Livelihood Sustenance among Rural and Urban Populations in Nigeria

Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.

A Review: Comparative Study of Diverse Collection of Data Mining Tools

There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.

Parallel Particle Swarm Optimization Optimized LDI Controller with Lyapunov Stability Criterion for Nonlinear Structural Systems

In this paper, we present a neural-network (NN) based approach to represent a nonlinear Tagagi-Sugeno (T-S) system. A linear differential inclusion (LDI) state-space representation is utilized to deal with the NN models. Taking advantage of the LDI representation, the stability conditions and controller design are derived for a class of nonlinear structural systems. Moreover, the concept of utilizing the Parallel Particle Swarm Optimization (PPSO) algorithm to solve the common P matrix under the stability criteria is given in this paper.

Simulation of Die Casting Process in an Industrial Helical Gearbox Flange Die

Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.

Material Characterization and Numerical Simulation of a Rubber Bumper

Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.

The Impact of Training Method on Programming Learning Performance

Although several factors that affect learning to program have been identified over the years, there continues to be no indication of any consensus in understanding why some students learn to program easily and quickly while others have difficulty. Seldom have researchers considered the problem of how to help the students enhance the programming learning outcome. The research had been conducted at a high school in Taiwan. Students participating in the study consist of 330 tenth grade students enrolled in the Basic Computer Concepts course with the same instructor. Two types of training methods-instruction-oriented and exploration-oriented were conducted. The result of this research shows that the instruction-oriented training method has better learning performance than exploration-oriented training method.

Detection ofTensile Forces in Cable-Stayed Structures Using the Advanced Hybrid Micro-Genetic Algorithm

This study deals with an advanced numerical techniques to detect tensile forces in cable-stayed structures. The proposed method allows us not only to avoid the trap of minimum at initial searching stage but also to find their final solutions in better numerical efficiency. The validity of the technique is numerically verified using a set of dynamic data obtained from a simulation of the cable model modeled using the finite element method. The results indicate that the proposed method is computationally efficient in characterizing the tensile force variation for cable-stayed structures.

Sustainability as a Criterion in the Reconstruction of Libya’s Public Transport Infrastructure

Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Farmers’ Awareness and Behavior of Chemical Pesticide Uses in Suan Luang Sub-District Municipality, Ampawa, Samut Songkram, Thailand

This paper is aimed to investigate farmers’ level of awareness and behavior of chemical pesticide uses, by using a case study of Suan Luang Sub- District Municipality, Ampawa, Samut Songkram Province. Questionnaire was employed in this study with the farmers from 46 households to explore their level of awareness in chemical pesticide uses, while interview and observation were adopted in exploring their behavior of chemical pesticide uses. The findings reflected the farmers’ high level of awareness in chemical pesticide uses in the hazardous effects of the chemical to human and environmental health, while their behavior of chemical pesticide uses explained their awareness paid to the right way of using pesticides, for instance reading the direction on the label, keeping children and animals away from the area of pesticide mixing, covering body with clothes and wearing hat and mask, no smoking, eating or drinking during pesticide spray or standing in windward direction.

Angle of Arrival Detection with Fifth Order Phase Operators

In this paper, a fifth order propagator operators are proposed for estimating the Angles Of Arrival (AOA) of narrowband electromagnetic waves impinging on antenna array when its number of sensors is larger than the number of radiating sources. The array response matrix is partitioned into five linearly dependent phases to construct the noise projector using five different propagators from non diagonal blocks of the spectral matrice of the received data; hence, five different estimators are proposed to estimate the angles of the sources. The simulation results proved the performance of the proposed estimators in the presence of white noise comparatively to high resolution eigen based spectra.

Angles of Arrival Estimation with Unitary Partial Propagator

In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem.  Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA). Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.

Design and Implementation of a Control System for a Walking Robot with Color Sensing and Line Following Using PIC and ATMEL Microcontrollers

The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.