Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: In recent years, geographic information systems (GIS)
and remote sensing using has increased to estimate runoff catchment.
In this research, runoff curve number maps for captive catchment of
Tehran by helping GIS and also remote sensing which based on
factors such as vegetation, lands using, group of soil hydrology and
hydrological conditions were obtained. Runoff curve numbers map
was obtained by combining these maps in ARC GIS and SCS table.
To evaluate the accuracy of the results, the maximum flow rate of
flood which was obtained from curve numbers, was compared with
the measured maximum flood rate at the watershed outlet and
correctness of curve numbers were approved.
Abstract: Effect of 2wt% Cu addition on tensile properties and
fracture behavior of Al-6Si-0.5Mg-2Ni alloy at various strain rates
were studied. The solution treated Al-6Si-0.5Mg-2Ni (-2Cu) alloys,
were aged isochronally for 1 hour at temperatures up to 300oC. The
uniaxial tension test was carried out at strain rate ranging from 10-4s-1
to 10-2s-1 in order to investigate the strain rate dependence of tensile
properties. Tensile strengths were found to increase with ageing
temperature and the maximum being attained ageing for 1 hr at
225oC (peak aged condition). Addition of 2wt% Cu resulted in an
increase in tensile properties at all strain rates. Evaluation of tensile
properties at three different strain rates (10-4, 10-3 and 10-2 s-1)
showed that strain rates affected the tensile properties significantly.
At higher strain rates the strength was better but ductility was poor.
Microstructures of broken specimens showed that both the void
coalescence and the interface debonding affect the fracture behavior
of the alloys
Abstract: Localization of mobile robots are important tasks for
developing autonomous mobile robots. This paper proposes a method
to estimate positions of a mobile robot using a omnidirectional
camera on the robot. Landmarks for points of references are set
up on a field where the robot works. The omnidirectional camera
which can obtain 360 [deg] around images takes photographs of
these landmarks. The positions of the robots are estimated from
directions of these landmarks that are extracted from the images
by image processing. This method can obtain the robot positions
without accumulative position errors. Accuracy of the estimated
robot positions by the proposed method are evaluated through some
experiments. The results show that it can obtain the positions with
small standard deviations. Therefore the method has possibilities of
more accurate localization by tuning of appropriate offset parameters.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: Farmers are in need of regular and relevant information relating to new technologies. Production of extension materials has been found to be useful in facilitating the process. Extension materials help to provide information to reach large numbers of farmers quickly and economically. However, as good as extension materials are, previous materials produced are not used by farmers. The reasons for this include lack of involvement of farmers in the production of the extension materials, most of the extension materials are not relevant to the farmers’ environments, the agricultural extension agents lack capacity to prepare the materials, and many extension agents lack commitment. These problems led to this innovative capacity building of extension agents. This innovative approach involves five stages. The first stage is the diagnostic survey of farmers’ environment to collect useful information. The second stage is the development and production of draft extension materials. The third stage is the field testing and evaluation of draft materials by the same famers that were involved at the diagnostic stage. The fourth stage is the revision of the draft extension materials by incorporating suggestions from farmers. The fifth stage is the action plans. This process improves the capacity of agricultural extension agents in the preparation of extension materials and also promotes engagement of farmers and beneficiaries in the process. The process also makes farmers assume some level of ownership of the exercise and the extension materials.
Abstract: There are several types of metal-based devices conceived as dampers for the seismic energy absorber whereby damages to the major structural components could be minimized for both new and existing structures. This paper aimed to develop and evaluate structural performance of slit circular shear panel damper for passive seismic energy protection by inelastic deformation. Structural evaluation was done using commercially available nonlinear FE simulation program. The main parameters considered are: diameter-to-thickness (D/t) ratio and slit length-to-width ratio (l/w). Depending on these parameters three different buckling mode and hysteretic behavior was found: yielding prior to buckling without strength degradation, yielding prior to buckling with strength degradation and yielding with buckling and strength degradation which forms pinching at initial displacement. The susceptible location at which the possible crack is initiated is also identified for selected specimens using rupture index.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Lately, with the increasing number of location-based applications, demand for highly accurate and reliable indoor localization became urgent. This is a challenging problem, due to the measurement variance which is the consequence of various factors like obstacles, equipment properties and environmental changes in complex nature of indoor environments. In this paper we propose low-cost custom-setup infrastructure solution and localization algorithm based on the Weighted Centroid Localization (WCL) method. Localization accuracy is increased by several enhancements: calibration of RSSI values gained from wireless nodes, repetitive measurements of RSSI to exclude deviating values from the position estimation, and by considering orientation of the device according to the wireless nodes. We conducted several experiments to evaluate the proposed algorithm. High accuracy of ~1m was achieved.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: The aim of this work is to analyze a viscous flow
around the axisymmetric blunt body taken into account the mesh size
both in the free stream and into the boundary layer. The resolution of
the Navier-Stokes equations is realized by using the finite volume
method to determine the flow parameters and detached shock
position. The numerical technique uses the Flux Vector Splitting
method of Van Leer. Here, adequate time stepping parameter, CFL
coefficient and mesh size level are selected to ensure numerical
convergence. The effect of the mesh size is significant on the shear
stress and velocity profile. The best solution is obtained with using a
very fine grid. This study enabled us to confirm that the
determination of boundary layer thickness can be obtained only if the
size of the mesh is lower than a certain value limits given by our
calculations.
Abstract: Hand grip strength has been utilized as an indicator to evaluate the motor ability of hands, responsible for performing multiple body functions. It is, however, difficult to evaluate other factors (other than hand muscular strength) utilizing the hand grip strength only. In this study, we analyzed the motor ability of hands using EMG and the hand grip strength, simultaneously in order to evaluate concentration, muscular strength reaction time, instantaneous muscular strength change, and agility in response to visual reaction. In results, the average time (and their standard deviations) of muscular strength reaction EMG signal and hand grip strength was found to be 209.6 ± 56.2 ms and 354.3 ± 54.6 ms, respectively. In addition, the onset time which represents acceleration time to reach 90% of maximum hand grip strength, was 382.9 ± 129.9 ms.
Abstract: Nanoscale thermites such as the composite mixture of
nano-sized aluminum and molybdenum trioxide powders possess
several technical advantages such as much higher reaction rate and
shorter ignition delay, when compared to the conventional energetic
formulations made of micron-sized metal and oxidizer particles. In this
study, the self-propagation of combustion wave in compacted pellets
of nanoscale thermite composites is modeled and computationally
investigated by utilizing the activation energy reduction of aluminum
particles due to nanoscale particle sizes. The present computational
model predicts the speed of combustion wave propagation which is
good agreement with the corresponding experiments of thermite
reaction. Also, several characteristics of thermite reaction in nanoscale
composites are discussed including the ignition delay and combustion
wave structures.
Abstract: To measure or asses any government’s efficiency we need to measure the performance of this government in regards to the quality of the service it provides. Using a technological platform in service provision became a trend and a public demand. It is also a public need to make sure these services are aligned to values and to the whole government’s strategy, vision and goals as well. Providing services using technology tools and channels can enhance the internal business process and also help establish many essential values to government services like transparency and excellence, since in order to establish e-services many standards and policies must be put in place to enable the handing over of decision making to a mature system oriented mechanism. There was no doubt that the Sultanate of Oman wanted to enhance its services and move it towards automation and establishes a smart government as well as links its services to life events. Measuring government efficiency is very essential in achieving social security and economic growth, since it can provide a clear dashboard of all projects and improvements. Based on this data we can improve the strategies and align the country goals to them.
Abstract: This paper presents the effect of electric field
distribution which is an electric field intensity analysis. Consideration
of the dielectric heating of grains and insects, the rice and rice
weevils are utilized for dielectric heating analysis. Furthermore, this
analysis compares the effect of electric field distribution in rice and
rice weevil. In this simulation, two copper plates are used to generate
the electric field for dielectric heating system and put the rice
materials between the copper plates. The simulation is classified in
two cases, which are case I one rice weevil is placed in the rice and
case II two rice weevils are placed at different position in the rice.
Moreover, the probes are located in various different positions on
plate. The power feeding on this plate is optimized by using CST EM
studio program of 1000 watt electrical power at 39 MHz resonance
frequency. The results of two cases are indicated that the most
electric field distribution and intensity are occurred on the rice and
rice weevils at the near point of the probes. Moreover, the heat is
directed to the rice weevils more than the rice. When the temperature
of rice and rice weevils are calculated and compared, the rice weevils
has the temperature more than rice is about 41.62 Celsius degrees.
These results can be applied for the dielectric heating applications to
eliminate insect.
Abstract: The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.
Abstract: This paper presents breast cancer detection by
observing the specific absorption rate (SAR) intensity for
identification tumor location, the tumor is identified in coordinates
(x,y,z) system. We examined the frequency between 4-8 GHz to look
for the most appropriate frequency. Results are simulated in
frequency 4-8 GHz, the model overview include normal breast with
50 mm radian, 5 mm diameter of tumor, and ultra wideband (UWB)
bowtie antenna. The models are created and simulated in CST
Microwave Studio. For this simulation, we changed antenna to 5
location around the breast, the tumor can be detected when an
antenna is close to the tumor location, which the coordinate of
maximum SAR is approximated the tumor location. For reliable, we
experiment by random tumor location to 3 position in the same size
of tumor and simulation the result again by varying the antenna
position in 5 position again, and it also detectable the tumor position
from the antenna that nearby tumor position by maximum value of
SAR, which it can be detected the tumor with precision in all
frequency between 4-8 GHz.