Scholarly

Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women

Year: 2014 Volume: 8 Issue: 9 618 - 621 Pages

Abstract: Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.

Multi-Wavelength Q-Switched Erbium-Doped Fiber Laser with Photonic Crystal Fiber and Multi-Walled Carbon Nanotubes

Year: 2014 Volume: 8 Issue: 10 1288 - 1291 Pages

Abstract: A simple multi-wavelength passively Q-switched Erbium-doped fiber laser (EDFL) is demonstrated using low cost multi-walled carbon nanotubes (MWCNTs) based saturable absorber (SA), which is prepared using polyvinyl alcohol (PVA) as a host polymer. The multi-wavelength operation is achieved based on nonlinear polarization rotation (NPR) effect by incorporating 50 m long photonic crystal fiber (PCF) in the ring cavity. The EDFL produces a stable multi-wavelength comb spectrum for more than 14 lines with a fixed spacing of 0.48 nm. The laser also demonstrates a stable pulse train with the repetition rate increases from 14.9 kHz to 25.4 kHz as the pump power increases from the threshold power of 69.0 mW to the maximum pump power of 133.8 mW. The minimum pulse width of 4.4 μs was obtained at the maximum pump power of 133.8 mW while the highest energy of 0.74 nJ was obtained at pump power of 69.0 mW.

RBF Modelling and Optimization Control for Semi-Batch Reactors

Year: 2014 Volume: 8 Issue: 7 714 - 718 Pages

Abstract: This paper presents a neural network based model predictive control (MPC) strategy to control a strongly exothermic reaction with complicated nonlinear kinetics given by Chylla-Haase polymerization reactor that requires a very precise temperature control to maintain product uniformity. In the benchmark scenario, the operation of the reactor must be guaranteed under various disturbing influences, e.g., changing ambient temperatures or impurity of the monomer. Such a process usually controlled by conventional cascade control, it provides a robust operation, but often lacks accuracy concerning the required strict temperature tolerances. The predictive control strategy based on the RBF neural model is applied to solve this problem to achieve set-point tracking of the reactor temperature against disturbances. The result shows that the RBF based model predictive control gives reliable result in the presence of some disturbances and keeps the reactor temperature within a tight tolerance range around the desired reaction temperature.

Development of Web-Based Remote Desktop to Provide Adaptive User Interfaces in Cloud Platform

Year: 2014 Volume: 8 Issue: 8 1416 - 1420 Pages

Abstract: Cloud virtualization technologies are becoming more and more prevalent, cloud users usually encounter the problem of how to access to the virtualized remote desktops easily over the web without requiring the installation of special clients. To resolve this issue, we took advantage of the HTML5 technology and developed web-based remote desktop. It permits users to access the terminal which running in our cloud platform from anywhere. We implemented a sketch of web interface following the cloud computing concept that seeks to enable collaboration and communication among users for high performance computing. Given the development of remote desktop virtualization, it allows to shift the user’s desktop from the traditional PC environment to the cloud platform, which is stored on a remote virtual machine rather than locally. This proposed effort has the potential to positively provide an efficient, resilience and elastic environment for online cloud service. This is also made possible by the low administrative costs as well as relatively inexpensive end-user terminals and reduced energy expenses.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Year: 2014 Volume: 8 Issue: 7 765 - 771 Pages

Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Medical Image Fusion Based On Redundant Wavelet Transform and Morphological Processing

Year: 2014 Volume: 8 Issue: 6 1036 - 1040 Pages

Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.

Cloud Computing Support for Diagnosing Researches

Year: 2014 Volume: 8 Issue: 4 680 - 684 Pages

Abstract: One of the main biomedical problem lies in detecting dependencies in semi structured data. Solution includes biomedical portal and algorithms (integral rating health criteria, multidimensional data visualization methods). Biomedical portal allows to process diagnostic and research data in parallel mode using Microsoft System Center 2012, Windows HPC Server cloud technologies. Service does not allow user to see internal calculations instead it provides practical interface. When data is sent for processing user may track status of task and will achieve results as soon as computation is completed. Service includes own algorithms and allows diagnosing and predicating medical cases. Approved methods are based on complex system entropy methods, algorithms for determining the energy patterns of development and trajectory models of biological systems and logical–probabilistic approach with the blurring of images.

Modeling and Control Design of a Centralized Adaptive Cruise Control System

Year: 2014 Volume: 8 Issue: 7 1197 - 1201 Pages

Abstract: A vehicle driving with an Adaptive Cruise Control System (ACC) is usually controlled decentrally, based on the information of radar systems and in some publications based on C2X-Communication (CACC) to guarantee stable platoons. In this paper we present a Model Predictive Control (MPC) design of a centralized, server-based ACC-System, whereby the vehicular platoon is modeled and controlled as a whole. It is then proven that the proposed MPC design guarantees asymptotic stability and hence string stability of the platoon. The Networked MPC design is chosen to be able to integrate system constraints optimally as well as to reduce the effects of communication delay and packet loss. The performance of the proposed controller is then simulated and analyzed in an LTE communication scenario using the LTE/EPC Network Simulator LENA, which is based on the ns-3 network simulator.

Model Predictive 2DOF PID Slip Suppression Control of Electric Vehicle under Braking

Year: 2014 Volume: 8 Issue: 7 1171 - 1176 Pages

Authors:
Tohru Kawabe

Abstract: In this paper, a 2DOF (two degrees of freedom) PID (Proportional-Integral-Derivative) controller based on MPC (Model predictive control) algorithm fo slip suppression of EV (Electric Vehicle) under braking is proposed. The proposed method aims to improve the safety and the stability of EVs under braking by controlling the wheel slip ration. There also include numerical simulation results to demonstrate the effectiveness of the method.

Synthesis of Magnesium Borates from the Slurries of Magnesium Wastes by Microwave Energy

Year: 2014 Volume: 8 Issue: 7 661 - 665 Pages

Abstract: In this research, it is aimed not only microwave synthesis of magnesium borates but also evaluation of magnesium wastes. Synthesis process can be described with the reaction of Mg wastes and boric acid using microwave energy. X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) were applied to synthesized minerals. According to XRD results, magnesium borate hydrate mixtures were obtained as mcallisterite (pdf# = 01-070-1902, Mg2(B6O7(OH)6)2.9(H2O)) at higher crystallinity properties was achieved at the mole ratio raw material 1:1. Also, other kinds of magnesium borate hydrates were obtained at lower crystallinity such as admontite (pdf # = 01-076-0540, MgO(B2O3)3.7(H2O)), inderite (pdf # = 01-072-2308, 2MgO.3B2O3.15(H2O)) and magnesium borate hydrates (pdf # = 01-076-0539, MgO(B2O3)3.6(H2O)). FT-IR spectrums indicated that minor changes were seen at the band values of characteristic stretching in each experiment. At the end of experiments it is seen that using microwave energy may contribute positive effects to design of synthesis process such as reducing reaction time and products at higher crystallinity.

The Determination of the Zinc Sulfate, Sodium Hydroxide and Boric Acid Molar Ratio on the Production of Zinc Borates

Year: 2014 Volume: 8 Issue: 7 656 - 660 Pages

Abstract: Zinc borate is an important boron compound that can be used as multi-functional flame retardant additive due to its high dehydration temperature property. In this study, theraw materials of ZnSO4.7H2O, NaOH and H3BO3werecharacterized by X-Ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR) and used in the synthesis of zinc borates.The synthesis parameters were set to 100°C reaction temperature and 120 minutes of reaction time, with different molar ratio of starting materials (ZnSO4.7H2O:NaOH:H3BO3). After the zinc borate synthesis, the identifications of the products were conducted by XRD and FT-IR. As a result,Zinc Oxide Borate Hydrate [Zn3B6O12.3.5H2O], were synthesized at the molar ratios of 1:1:3, 1:1:4, 1:2:5 and 1:2:6. Among these ratios 1:2:6 had the best results.

RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars

Year: 2014 Volume: 8 Issue: 7 689 - 693 Pages

Abstract: In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

Optical Properties of WO3-NiO Complementary Electrochromic Devices

Year: 2014 Volume: 8 Issue: 7 641 - 644 Pages

Abstract: In this study, we developed a complementary electrochromic device consisting of WO3 and NiO films fabricated by rf-magnetron sputtered. The electrochromic properties of WO3 and NiO films were investigated using cyclic voltammograms (CV), performed on WO3 and NiO films immersed in an electrolyte of 1 M LiClO4 in propylene carbonate (PC). Optical and electrochemical of the films, as a function of coloration–bleaching cycle, were characterized using an UV-Vis-NIR spectrophotometer and cyclic voltammetry (CV). After investigating the properties of WO3 film, NiO film, and complementary electrochromic devices, we concluded that this device provides good reversibility, low power consumption of -2.5 V in color state, high variation of transmittance of 58.96%, changes in optical density of 0.81 and good memory effect under open-circuit conditions. In addition, electrochromic component penetration rate can be retained below 20% within 24h, showing preferred memory features; however, component coloring and bleaching response time are about 33s.

The Effect of Sodium Bicarbonate on the Mg and P Concentrations in Turkish Black and Green Tea

Year: 2014 Volume: 8 Issue: 6 574 - 577 Pages

Abstract: Tea is one of the most consumed beverages all over the world. Especially, black and green teas are preferred to consume. In Turkey, some local tea houses use sodium bicarbonate (SB) to obtain more infusion by using less than the amount of tea. Therefore, the addition of SB to black and green teas affects element concentrations of these teas. In this study, determination of magnesium (Mg) and phosphorus (P) contents in black and green teas aimed for conscious consumption, after the addition of SB. Inductively coupled plasma optical emission spectrometry (ICP-OES) was used for these analysis. The results of this study showed that the concentrations of Mg and P decreased by adding SB from 11.020, 21.915 to 10.009, 17.520 in black tea and from 12.605, 14.550 to 8.118, 9.425 in green tea, respectively. The addition of SB on analyzed teas is not recommended to cause reducing intake percentages of Mg and P from the essential elements.

The Effect of the Reaction Time on the Microwave Synthesis of Magnesium Borates from MgCl2.6H2O, MgO and H3BO3

Year: 2014 Volume: 8 Issue: 6 569 - 573 Pages

Abstract: Due to their strong mechanical and thermal properties magnesium borates have a wide usage area such as ceramic industry, detergent production, friction reducing additive and grease production. In this study, microwave synthesis of magnesium borates from MgCl2.6H2O (Magnesium chloride hexahydrate), MgO (Magnesium oxide) and H3BO3 (Boric acid) for different reaction times is researched. X-ray Diffraction (XRD) and Fourier Transform Infrared (FT-IR) Spectroscopy are used to find out how the reaction time sways on the products. The superficial properties are investigated with Scanning Electron Microscopy (SEM). According to XRD analysis, the synthesized compounds are 00-041-1407 pdf coded Shabinite (Mg5(BO3)4Cl2(OH)5.4(H2O)) and 01-073-2158 pdf coded Karlite (Mg7(BO3)3(OH,Cl)5).

Purity Monitor Studies in Medium Liquid Argon TPC

Year: 2014 Volume: 8 Issue: 2 468 - 474 Pages

Authors:
I. Badhrees

Abstract: This paper is an attempt to describe some of the results that had been found through a journey of study in the field of particle physics. This study consists of two parts, one about the measurement of the cross section of the decay of the Z particle in two electrons, and the other deals with the measurement of the cross section of the multi-photon absorption process using a beam of Laser in the Liquid Argon Time Projection Chamber. The first part of the paper concerns the results based on the analysis of a data sample containing 8120 ee candidates to reconstruct the mass of the Z particle for each event where each event has an ee pair with PT(e) > 20GeV, and η(e) < 2.5. Monte Carlo templates of the reconstructed Z particle were produced as a function of the Z mass scale. The distribution of the reconstructed Z mass in the data was compared to the Monte Carlo templates, where the total cross section is calculated to be equal to 1432pb. The second part concerns the Liquid Argon Time Projection Chamber, LAr TPC, the results of the interaction of the UV Laser, Nd-YAG with λ= 266mm, with LAr and through the study of the multi-photon ionization process as a part of the R&D at Bern University. The main result of this study was the cross section of the process of the multi-photon ionization process of the LAr, σe = 1.24±0.10stat±0.30sys.10 -56cm4.

Automatic Facial Skin Segmentation Using Possibilistic C-Means Algorithm for Evaluation of Facial Surgeries

Year: 2014 Volume: 8 Issue: 6 997 - 1001 Pages

Abstract: Human face has a fundamental role in the appearance of individuals. So the importance of facial surgeries is undeniable. Thus, there is a need for the appropriate and accurate facial skin segmentation in order to extract different features. Since Fuzzy CMeans (FCM) clustering algorithm doesn’t work appropriately for noisy images and outliers, in this paper we exploit Possibilistic CMeans (PCM) algorithm in order to segment the facial skin. For this purpose, first, we convert facial images from RGB to YCbCr color space. To evaluate performance of the proposed algorithm, the database of Sahand University of Technology, Tabriz, Iran was used. In order to have a better understanding from the proposed algorithm; FCM and Expectation-Maximization (EM) algorithms are also used for facial skin segmentation. The proposed method shows better results than the other segmentation methods. Results include misclassification error (0.032) and the region’s area error (0.045) for the proposed algorithm.

Overview Studies of High Strength Self-Consolidating Concrete

Year: 2014 Volume: 8 Issue: 6 709 - 713 Pages

Abstract: Self-Consolidating Concrete (SCC) is considered as a relatively new technology created as an effective solution to problems associated with low quality consolidation. A SCC mix is defined as successful if it flows freely and cohesively without the intervention of mechanical compaction. The construction industry is showing high tendency to use SCC in many contemporary projects to benefit from the various advantages offered by this technology. At this point, a main question is raised regarding the effect of enhanced fluidity of SCC on the structural behavior of high strength self-consolidating reinforced concrete. A three phase research program was conducted at the American University of Beirut (AUB) to address this concern. The first two phases consisted of comparative studies conducted on concrete and mortar mixes prepared with second generation Sulphonated Naphtalene-based superplasticizer (SNF) or third generation Polycarboxylate Ethers-based superplasticizer (PCE). The third phase of the research program investigates and compares the structural performance of high strength reinforced concrete beam specimens prepared with two different generations of superplasticizers that formed the unique variable between the concrete mixes. The beams were designed to test and exhibit flexure, shear, or bond splitting failure. The outcomes of the experimental work revealed comparable resistance of beam specimens cast using self-compacting concrete and conventional vibrated concrete. The dissimilarities in the experimental values between the SCC and the control VC beams were minimal, leading to a conclusion, that the high consistency of SCC has little effect on the flexural, shear and bond strengths of concrete members.

Evaluation of the Environmental Risk from the Co-Deposition of Waste Rock Material and Fly Ash

Year: 2014 Volume: 8 Issue: 6 390 - 396 Pages

Abstract: The lignite-fired power plants in the Western Macedonia Lignite Center produce more than 8106 t of fly ash per year. Approximately 90% of this quantity is used for restoration-reclamation of exhausted open-cast lignite mines and slope stabilization of the overburden. The purpose of this work is to evaluate the environmental behavior of the mixture of waste rock and fly ash that is being used in the external deposition site of the South Field lignite mine. For this reason, a borehole was made within the site and 86 samples were taken and subjected to chemical analyses and leaching tests. The results showed very limited leaching of trace elements and heavy metals from this mixture. Moreover, when compared to the limit values set for waste acceptable in inert waste landfills, only few excesses were observed, indicating only minor risk for groundwater pollution. However, due to the complexity of both the leaching process and the contaminant pathway, more boreholes and analyses should be made in nearby locations and a systematic groundwater monitoring program should be implemented both downstream and within the external deposition site.

Analysis of Vocal Fold Vibrations from High-Speed Digital Images Based On Dynamic Time Warping

Year: 2014 Volume: 8 Issue: 6 306 - 309 Pages

Abstract: Analysis of vocal fold vibration is essential for understanding the mechanism of voice production and for improving clinical assessment of voice disorders. This paper presents a Dynamic Time Warping (DTW) based approach to analyze and objectively classify vocal fold vibration patterns. The proposed technique was designed and implemented on a Glottal Area Waveform (GAW) extracted from high-speed laryngeal images by delineating the glottal edges for each image frame. Feature extraction from the GAW was performed using Linear Predictive Coding (LPC). Several types of voice reference templates from simulations of clear, breathy, fry, pressed and hyperfunctional voice productions were used. The patterns of the reference templates were first verified using the analytical signal generated through Hilbert transformation of the GAW. Samples from normal speakers’ voice recordings were then used to evaluate and test the effectiveness of this approach. The classification of the voice patterns using the technique of LPC and DTW gave the accuracy of 81%.

Top Journal

SUGGEST A JOURNAL