Abstract: The present study is an analysis of the forced convection heat transfer in porous channel with an oriented jet at the inlet with uniform velocity and temperature distributions. The upper wall is insulated when the bottom one is kept at constant temperature higher than that of the fluid at the entrance. The dynamic field is analysed by the Brinkman-Forchheimer extended Darcy model and the thermal field is traduced by the energy one equation model. The numerical solution of the governing equations is obtained by using the finite volume method. The results mainly concern the effect of Reynolds number, jet angle and thermal conductivity ratio on the flow structure and local and average Nusselt numbers evolutions.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Power quality has become a very important issue recently due to the impact on electricity suppliers, equipment manufacturers and customers. Power quality is described as the variation of voltage, current and frequency in a power system. Voltage magnitude is one of the major factors that determine the quality of power. Indeed, custom power technology, the low-voltage counterpart of the more widely known flexible ac transmission system (FACTS) technology, aimed at high-voltage power transmission applications, has emerged as a credible solution to solve many problems relating to power quality problems. There are various power quality problems such as voltage sags, swells, flickers, interruptions and harmonics etc. Active Power Filter (APF) is one of the custom power devices and can mitigate harmonics, reactive power and unbalanced load currents originating from load side. In this study, an extensive review of APF studies, the advantages and disadvantages of each introduced methods are presented. The study also helps the researchers to choose the optimum control techniques and power circuit configuration for APF applications.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: In this paper, we investigated the effect of real valued transformation of the spectral matrix of the received data for Angles Of Arrival estimation problem. Indeed, the unitary transformation of Partial Propagator (UPP) for narrowband sources is proposed and applied on Uniform Linear Array (ULA).
Monte Carlo simulations proved the performance of the UPP spectrum comparatively with Forward Backward Partial Propagator (FBPP) and Unitary Propagator (UP). The results demonstrates that when some of the sources are fully correlated and closer than the Rayleigh angular limit resolution of the broadside array, the UPP method outperforms the FBPP in both of spatial resolution and complexity.
Abstract: The aim of this research is to design and implement line-tracking mobile robot. The robot must follow a line drawn on the floor with different color, avoids hitting moving object like another moving robot or walking people and achieves color sensing. The control system reacts by controlling each of the motors to keep the tracking sensor over the middle of the line. Proximity sensors used to avoid hitting moving objects that may pass in front of the robot. The programs have been written using micro c instructions, then converted into PIC16F887 ATmega48/88/168 microcontrollers counterparts. Practical simulations show that the walking robot accurately achieves line following action and exactly recognizes the colors and avoids any obstacle in front of it.
Abstract: Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented. Effects of insertion of coiled wire in juxtaposition with twisted tapes on heat transfer rate and solar radiation without disturbing the flow inside the riser tubes in a solar flat plate collector is experimentally reconnoitered in this present work. The wire coil used as a turbulator is placed inside the riser tube while the twisted tape is inserted into the wire coil to create a continuous swirling flow along the tube wall. The results of the heat transfer have been compared well with the available results. The heat transfer rate in the collector has been found to be increased by 18% to 70%. Solar water heaters having inserts in the flow tubes perform better than the conventional plain ones. It has been observed that heat losses are reduced consequently increasing the thermal performance about 30% over the plain water heaters under the same operating conditions. The effect of twisted tape with wire coils, flow Reynolds number, and the intensity of solar radiation on the thermal performance of the solar water heater has been presented.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: The semiconductor industry is placing an increased
emphasis on emerging materials and devices that may provide
improved performance, or provide novel functionality for devices.
Recently, graphene, as a true two-dimensional carbon material, has
shown fascinating applications in electronics. In this paper detailed
discussions are introduced for possible applications of grapheme
Transistor in RF and digital devices.
Abstract: Non-synchronous breakage or line failure in power
systems with light or no loads can lead to core saturation in
transformers or potential transformers. This can cause component and
capacitance matching resulting in the formation of resonant circuits,
which trigger ferroresonance. This study employed a wavelet
transform for the detection of ferroresonance. Simulation results
demonstrate the efficacy of the proposed method.
Abstract: This paper presents feature level image fusion using Haar lifting wavelet transform. Feature fused is edge and boundary information, which is obtained using wavelet transform modulus maxima criteria. Simulation results show the superiority of the result as entropy, gradient, standard deviation are increased for fused image as compared to input images. The proposed methods have the advantages of simplicity of implementation, fast algorithm, perfect reconstruction, and reduced computational complexity. (Computational cost of Haar wavelet is very small as compared to other lifting wavelets.)
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Object detection using Wavelet Neural Network (WNN) plays a major contribution in the analysis of image processing. Existing cluster-based algorithm for co-saliency object detection performs the work on the multiple images. The co-saliency detection results are not desirable to handle the multi scale image objects in WNN. Existing Super Resolution (SR) scheme for landmark images identifies the corresponding regions in the images and reduces the mismatching rate. But the Structure-aware matching criterion is not paying attention to detect multiple regions in SR images and fail to enhance the result percentage of object detection. To detect the objects in the high-resolution remote sensing images, Tagged Grid Matching (TGM) technique is proposed in this paper. TGM technique consists of the three main components such as object determination, object searching and object verification in WNN. Initially, object determination in TGM technique specifies the position and size of objects in the current image. The specification of the position and size using the hierarchical grid easily determines the multiple objects. Second component, object searching in TGM technique is carried out using the cross-point searching. The cross out searching point of the objects is selected to faster the searching process and reduces the detection time. Final component performs the object verification process in TGM technique for identifying (i.e.,) detecting the dissimilarity of objects in the current frame. The verification process matches the search result grid points with the stored grid points to easily detect the objects using the Gabor wavelet Transform. The implementation of TGM technique offers a significant improvement on the multi-object detection rate, processing time, precision factor and detection accuracy level.
Abstract: In this paper, an analytical study is made for the dynamic behavior of human brain tissue under transient loading. In this analytical model the Mooney-Rivlin constitutive law is coupled with visco-elastic constitutive equations to take into account both the nonlinear and time-dependent mechanical behavior of brain tissue. Five ordinary differential equations representing the relationships of five main parameters (radial stress, circumferential stress, radial strain, circumferential strain, and particle velocity) are obtained by using the characteristic method to transform five partial differential equations (two continuity equations, one motion equation, and two constitutive equations). Analytical expressions of the attenuation properties for spherical wave in brain tissue are analytically derived. Numerical results are obtained based on the five ordinary differential equations. The mechanical responses (particle velocity and stress) of brain are compared at different radii including 5, 6, 10, 15 and 25 mm under four different input conditions. The results illustrate that loading curves types of the particle velocity significantly influences the stress in brain tissue. The understanding of the influence by the input loading cures can be used to reduce the potentially injury to brain under head impact by designing protective structures to control the loading curves types.
Abstract: Traditional Wireless Sensor Networks (WSNs) generally use static sinks to collect data from the sensor nodes via multiple forwarding. Therefore, network suffers with some problems like long message relay time, bottle neck problem which reduces the performance of the network.
Many approaches have been proposed to prevent this problem with the help of mobile sink to collect the data from the sensor nodes, but these approaches still suffer from the buffer overflow problem due to limited memory size of sensor nodes. This paper proposes an energy efficient scheme for data gathering which overcomes the buffer overflow problem. The proposed scheme creates virtual grid structure of heterogeneous nodes. Scheme has been designed for sensor nodes having variable sensing rate. Every node finds out its buffer overflow time and on the basis of this cluster heads are elected. A controlled traversing approach is used by the proposed scheme in order to transmit data to sink. The effectiveness of the proposed scheme is verified by simulation.
Abstract: A Jet-stream airsail concept takes advantage of aerology
in order to fly without propulsion. Weather phenomena, especially jet
streams, are relatively permanent high winds blowing from west to
east, located at average altitudes and latitudes in both hemispheres.
To continuously extract energy from the jet-stream, the system is
composed of a propelled plane and a wind turbine interconnected by
a cable. This work presents the aerodynamic characteristics and the
behavior of the cable that links the two subsystems and transmits
energy from the turbine to the aircraft. Two ways of solving this
problem are explored: numerically and analytically. After obtaining
the optimal shape of the cross-section of the cable, its behavior
is analyzed as a 2D problem solved numerically and analytically.
Finally, a 3D extension could be considered by adding lateral forces.
The results of this work can be further used in the design process of
the overall system: aircraft-turbine.
Abstract: Experimental Film Class Project is supported by the Institute for Research and Development at Suan Sunandha Rajabhat University. This project is purported to provide academic and professional services to improve the quality standards of the community and locals in accordance with the mission of the university, which is to improve and expand knowledge for the community and to develop and transfer such knowledge and professions to the next generation. Eventually, it leads to sustainable development because the development of human resources is deemed as the key for sustainable development. Moreover, the Experimental Film Class is an integral part of the teaching of film production at Suan Sunandha International School of Art (SISA). By means of giving opportunities to students for participation in projects by sharing experience, skill and knowledge and participation in field activities, it helps students in the film production major to enhance their abilities and potentials as preparation for their readiness in the marketplace. Additionally, in this class, we provide basic film knowledge, screenwriting techniques, editing and subtitles including uploading videos on social media such as YouTube and Facebook for the participant students.
Abstract: The application of today's semiconductor transistors in high power UHF DVB-T linear amplifiers has evolved significantly by utilizing LDMOS technology. This fact provides engineers with the option to design a single transistor signal amplifier which enables output power and linearity that was unobtainable previously using bipolar junction transistors or later type first generation MOSFETS. The quiescent current stability in terms of thermal variations of the LDMOS guarantees a robust operation in any topology of DVB-T signal amplifiers. Otherwise, progressively uncontrolled heat dissipation enhancement on the LDMOS case can degrade the amplifier’s crucial parameters in regards to the gain, linearity and RF stability, resulting in dysfunctional operation or a total destruction of the unit. This paper presents one more sophisticated approach from the traditional biasing circuits used so far in LDMOS DVB-T amplifiers. It utilizes a microprocessor control technology, providing stability in topologies where IDQ must be perfectly accurate.