Abstract: The purpose of the present work is to review some
data for the management challenges that the aquaculture industry in
Greece is currently facing. The results indicate that Greek
aquaculture fish farms apply Human Resources Management (HRM)
practices which can increase motivation, commitment and job
satisfaction of their personnel. In turn, these practices can increase
the productivity of the business. The Greek fish farms appear to
invest in research and technological innovation with a good record in
research activities and the generation of patents. Interestingly, the
results of the present work were carried out during the period of the
recent economic crisis in Greece. Several sectors of the Greek
economy were severely affected by the financial problems of the
Greek government and the Greek banks. Under the adverse
economical conditions created by the Greek economic crisis, even the
Greek aquaculture industry, which historically is considered as a
thriving national exporting business sector, experienced harsh
economic and market conditions. As a result of the global, European
and national economic crisis, consumption of fish dropped while
companies had to hold most of their stocked fish in order to regulated
the flow to the market and the price. This occurred at a time where
Banks in Greece had their own financial crisis – banking crisis -
which resulted in limited access to lending for the all business sectors
of the national economy including the Greek aquaculture industry. In
spite of these economic conditions, the Greek aquaculture industry,
after a series of mergers and acquisitions, has now stabilized
production and exhibits very good prospects for future growth.
Evidently, the firms had to cut salaries and on some occasions even
pay their staff in arrears. Nevertheless, the results presented in this
paper indicate that during the economic crisis, the surveyed fish
farms maintained their HRM practices, investing in their human
capital and technological input. In fact, human capital and
technological input are the ticket for future success of companies in
any business sector.
Abstract: The organizations of European and Czech critical
infrastructure have specific position, mission, characteristics and
behaviour in European Union and Czech state/business environments,
regarding specific requirements for regional and global security
environments. They must respect policy of national security and
global rules, requirements and standards in all their inherent and
outer processes of supply - customer chains and networks. A
controlling is generalized capability to have control over situational
policy. This paper aims and purposes are to introduce the controlling
as quite new necessary process attribute providing for critical
infrastructure is environment the capability and profit to achieve its
commitment regarding to the effectiveness of the quality
management system in meeting customer/ user requirements and also
the continual improvement of critical infrastructure organization’s
processes overall performance and efficiency, as well as its societal
security via continual planning improvement via DYVELOP
modelling.
Abstract: In order to efficiently solve the problems created by the deepening energy crisis affecting Europe and the world,
governments cannot neglect the opportunities of using the energy
produced by sun collectors. In many of the EU countries there are sun
collectors producing heat energy, e.g. in 2011 in the area of EU27
(countries which belong to European Union) + Switzerland altogether
37519126 m2 were operated, which are capable of producing 26.3
GWh heat energy. The energy produced by these sun collectors is
utilized at the place of production. In the near future governments
will have to focus more on spreading and using sun collectors.
Among the complex problems of operating sun collectors, this article
deals with determining the optimal tilt angle, directions of sun
collectors. We evaluate the contamination of glass surface of sun
collector to the produced energy. Our theoretically results are confirmed by laboratory measurements. The purpose of our work is to help users and engineers in determination of optimal operation
parameters of sun collectors.
Abstract: This paper deals with a protection of the national and
European infrastructure. It is issue nowadays. The paper deals with
the perspectives and possibilities of "smart solutions" to critical
infrastructure protection. The research project deals with computers
aided technologies are used from the perspective of new, better
protection of selected infrastructure objects. Protection is focused on
communication and information channels. These communication and
information channels are very important for the functioning of the
system of protection of critical infrastructure elements.
Abstract: Estimation of a proportion has many applications in
economics and social studies. A common application is the estimation
of the low income proportion, which gives the proportion of people
classified as poor into a population. In this paper, we present this
poverty indicator and propose to use the logistic regression estimator
for the problem of estimating the low income proportion. Various
sampling designs are presented. Assuming a real data set obtained
from the European Survey on Income and Living Conditions, Monte
Carlo simulation studies are carried out to analyze the empirical
performance of the logistic regression estimator under the various
sampling designs considered in this paper. Results derived from
Monte Carlo simulation studies indicate that the logistic regression
estimator can be more accurate than the customary estimator under
the various sampling designs considered in this paper. The stratified
sampling design can also provide more accurate results.
Abstract: The European Union Survey on Income and Living
Conditions (EU-SILC) is a popular survey which provides
information on income, poverty, social exclusion and living
conditions of households and individuals in the European Union.
The EU-SILC contains variables which may contain outliers. The
presence of outliers can have an impact on the measures and
indicators used by the EU-SILC. In this paper, we used data sets
from various countries to analyze the presence of outliers. In addition,
we obtain some indicators after removing these outliers, and a
comparison between both situations can be observed. Finally, some
conclusions are obtained.
Abstract: The research about Formal Thai National Costume in the reign of King Bhumibol Adulyadej is an applied research that aimed to study the accurate knowledge concerning to Thai national costume in the reign of King Rama IX, also to study origin of all costumes in the reign of King Rama IX and to study the style, material used, and using accasion. This research methodology which are collect quanlitative data through observation, document, and photograph from key informant of costume in the reign of King Rama IX and from another who related to this field.
The formal Thai national costume of the reign of King Bhumibol Adulyadej originated from the visit of His Majesty the King to Europe and America in 1960. Since Thailand had no traditional national costume; Her Majesty the Queen initiated the idea to create formal Thai national costumes. In 1964, Her Majesty the Queen selected 8 styles of formal Thai national costume. Later, Her Majesty the Queen confered another 3 formal Thai national costume for men. There are 8 styles of formal Thai national costume for women: Thai Ruean Ton, Thai Chit Lada, Thai Amarin, Thai Borom Phiman, Thai Siwalia, Thai Chakkri, Thai Dusit, and Thai Chakkraphat. There are 3 styles of formal Thai national costume for men: short-sleeve shirt, long-sleeve shirt, and long-sleeve shirt with breechcloth. The costume is widely used in formal ceremony such as greeting ceremony for official foreign visitors, wedding ceremony, or other auspicious ceremonies. Now a day, they are always used as a bridal gown as well. The formal Thai national costume is valuable art that shows Thai identity and, should be preserved for the next generation.
Abstract: Mostly of public financing programs at national and regional level are funded from European Union sources. EU can participate directly to a national and regional program (example LEADER initiative, URBAN…) or indirectly by funding regional or national funds.Funds from European Union are provided from EU multiannual financial framework form which the annual budget is programmed. The adjusted program 2007-2013 of the EU considered commitments of almost 1 trillion Euros for the EU-28 countries. Provisions of the new program 2014-2020 consider commitments of more than 1 trillion Euros. Sustainable growth, divided to Cohesion and Competitiveness for Growth an Employment, is one of the two principal categories; the other is the preservation and management of natural resources.Through this financing process SMEs benefited of EU and public sources by receiving grants for their investments. Most of the financial instruments are available indirectly through the national financial intermediaries. Part of them is managed by the European Investment Fund.The paper focuses on the public financing to SMEs by examining case studies on divers forms of public help. It tries to distinguish the efficiency of the examined good practices and therefore try to have some conclusions on the possibility of application to other regions.
Abstract: This research aims to study tourism data and behavior
of foreign tourists visited Wat Phrachetuponwimolmangkalaram (Wat
Po) Sample groups are tourists who visited inside the temple, during
February, March, April and May 2013. Tools used in the research are
questionnaires constructed by the researcher, and samples are dawn
by Convenience sampling. There are 207 foreign tourists who are
willing to be respondents. Statistics used are percentage, average
mean and standard deviation.
The results of the research reveal that:
A. General Data of Respondents
The foreign tourists who visited the temple are mostly female
(57.5 %), most respondents are aged between 20-29 years (37.2%).
Most respondents live in Europe (62.3%), most of them got the
Bachelor’s degree (40.1%), British are mostly found (16.4%),
respondents who are students are also found (23.2%), and Christian
are mostly found (60.9%).
B. Tourists’ Behavior While Visiting the Temple Compound.
The result shows that the respondents came with family (46.4%),
have never visited the temples (40.6%), and visited once (42 %). It is
found that the foreign tourists’ inappropriate behavior are wearing
revealing attires (58.9%), touching or getting closed to the monks
(55.1%), and speaking loudly (46.9%) respectively.
The respondents’ outstanding objectives are to visit inside the
temple (57.5%), to pay respect to the Reclining Buddha Image in the
Viharn (44.4%) and to worship the Buddha image in the Phra Ubosod
(37.7%) respectively.
C. The Respondents’ Self-evaluation of Performance
It is found that over all tourists evaluated themselves in the highest
level averaged 4.40. When focusing on each item, it is shown that
they evaluated themselves in the highest level on obeying the temple
staff averaged 4.57, and cleanness concern of the temple averaged
4.52, well-behaved performance during the temple visit averaged
4.47 respectively.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Small and medium-sized enterprises (SME) are the backbone of central Europe’s economies and have a significant contribution to the gross domestic product. Production planning and scheduling (PPS) is still a crucial element in manufacturing industries of the 21st century even though this area of research is more than a century old. The topic of PPS is well researched especially in the context of large enterprises in the manufacturing industry. However the implementation of PPS methodologies within SME is mostly unobserved. This work analyzes how PPS is implemented in SME with the geographical focus on Switzerland and its vicinity. Based on restricted resources compared to large enterprises, SME have to face different challenges. The real problem areas of selected enterprises in regards of PPS are identified and evaluated. For the identified real-life problem areas of SME clear and detailed recommendations are created, covering concepts and best practices and the efficient usage of PPS. Furthermore the economic and entrepreneurial value for companies is lined out and why the implementation of the introduced recommendations is advised.
Abstract: Hanging to the trapezoidal sheet by decking hanger is a very widespread solution used in civil engineering to lead the distribution of energy, sanitary, air distribution system etc. under the roof or floor structure. The trapezoidal decking hanger is usually a part of the whole installation system for specific distribution medium. The leading companies offer installation systems for each specific distribution e.g. pipe rings, sprinkler systems, installation channels etc. Every specific part is connected to the base connector which is decking hanger. The own connection has three main components: decking hanger, threaded bar with nuts and web of trapezoidal sheet. The aim of this contribution is determinate the failure mechanism of each component in connection. Load bearing capacity of most components in connection could be calculated by formulas in European codes. This contribution is focused on problematic of bearing resistance of threaded bar in web of trapezoidal sheet. This issue is studied by experimental research and numerical modelling. This contribution presented the initial results of experiment which is compared with numerical model of specimen.
Abstract: In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.
Abstract: The Council of European Union (EU Council) has
stressed on several occasions the need for a concerted,
comprehensive and effective solution to delinquency problems in EU
communities. In the context of establishing a European Forensic
Science Area and the development of forensic science infrastructure
in Europe, EU Council believes that forensic science can significantly
contribute to the efficiency of law enforcement, crime prevention and
combating crimes. Lithuanian scientists have consolidated to
implement a project named “Conception of the vision for European
Forensic Science 2020 implementation in Lithuania” (the project is
funded for the period of 1 March 2014 - 31 December 2016) with the
objective to create a conception of implementation of the vision for
European Forensic Science 2020 in Lithuania by 1) evaluating the
current status of Lithuania’s forensic system and opportunities for its
improvement; 2) analysing achievements and knowledge in
investigation of crimes listed in conclusions of EU Council on the
vision for European Forensic Science 2020 including creation of a
European Forensic Science Area and the development of forensic
science infrastructure in Europe: trafficking in human beings,
organised crime and terrorism; 3) analysing conceptions of
criminalistics, which differ in different EU member states due to the
variety of forensic schools, and finding means for their
harmonization. Apart from the conception of implementation of the
vision for European Forensic Science 2020 in Lithuania, the Project
is expected to suggest provisions that will be relevant to other EU
countries as well. Consequently, the presented conception of
implementation of vision for European Forensic Science 2020 in
Lithuania could initiate a project for a common vision of European
Forensic Science and contribute to the development of the EU as an
area of freedom, security and justice. The article presents main ideas
of the project of the conception of the vision for European Forensic
Science 2020 of EU Council and analyses its legal background, as
well as prospects of and challenges for its implementation in
Lithuania and the EU.
Abstract: This research aims to study on “ASEAN Citizenship in the Internationalization of Thai Higher Education.” The purposes of this research are (1) to examine the Thai academics and scholars defined in the concept of internationalization of higher education, (2) to know how Thailand tries to fulfill its internationalization on education goal, (3) to find out the advantages and disadvantages of Thailand hub for higher education in Asia. Sequential mixed methods, qualitative and quantitative research methods were utilized to gather the data collected. By using a qualitative method (individual interviews from key Thai administrators and educators in the international higher education sector), a quantitative method (survey) was utilized to draw upon and to elaborate the recurring themes present during the interviews. The study found that many aspects of Thai international higher education programs received heavy influence from both the American and European higher education systems. Thailand’s role and leadership in the creation and launch of the ASEAN Economic Community (AEC) by 2015 gives its unique context for its internationalization efforts. English is being designated as the language of all Thai international programs; its influence further strengthened being the current language of academia, international business, and the internet, having global influence.
Abstract: Composting is a controlled technology to enhance the
natural aerobic process of organic wastes degradation. The resulting
product is a humified material that is principally recyclable for
agricultural purpose. The composting process is one of the most
important tools for waste management, by the European Community
legislation. In recent years composting has been increasingly used as
a remediation technology to remove biodegradable contaminants
from soil, and to modulate heavy metals bioavailability in
phytoremediation strategies. An optimization in the recovery of
resources from wastes through composting could enhance soil
fertility and promote its use in the remediation biotechnologies of
contaminated soils.
Abstract: Construction industry in Greece consumes annually
more than 25 million tons of natural aggregates originating mainly
from quarries. At the same time, more than 2 million tons of
construction and demolition waste are deposited every year, usually
without control, therefore increasing the environmental impact of this
sector. A potential alternative for saving natural resources and
minimize landfilling, could be the recycling and re-use of Concrete
and Demolition Waste (CDW) in concrete production. Moreover, in
order to conform to the European legislation, Greece is obliged to
recycle non-hazardous construction and demolition waste to a
minimum of 70% by 2020. In this paper characterization of recycled
materials - commercially and laboratory produced, coarse and fine,
Recycled Concrete Aggregates (RCA) - has been performed. Namely,
X-Ray Fluorescence and X-ray diffraction (XRD) analysis were used
for chemical and mineralogical analysis respectively. Physical
properties such as particle density, water absorption, sand equivalent
and resistance to fragmentation were also determined. This study,
first time made in Greece, aims at outlining the differences between
RCA and natural aggregates and evaluating their possible influence
in concrete performance. Results indicate that RCA’s chemical
composition is enriched in Si, Al, and alkali oxides compared to
natural aggregates. X-ray diffraction (XRD) analyses results
indicated the presence of calcite, quartz and minor peaks of mica and
feldspars. From all the evaluated physical properties of coarse RCA,
only water absorption and resistance to fragmentation seem to have a
direct influence on the properties of concrete. Low Sand Equivalent
and significantly high water absorption values indicate that fine
fractions of RCA cannot be used for concrete production unless
further processed. Chemical properties of RCA in terms of water
soluble ions are similar to those of natural aggregates. Four different
concrete mixtures were produced and examined, replacing natural
coarse aggregates with RCA by a ratio of 0%, 25%, 50% and 75%
respectively. Results indicate that concrete mixtures containing
recycled concrete aggregates have a minor deterioration of their
properties (3-9% lower compression strength at 28 days) compared to
conventional concrete containing the same cement quantity.
Abstract: The purpose of this study was to determine the significance of history of obesity for the development of childhood overweight and/or obesity. Accordingly, a systematic literature review of English-language studies published from 1980 to 2012 using the following data bases: MEDLINE, PsychINFO, Cochrane Database of Systematic Reviews, and Dissertation Abstracts International was conducted. The following terms were used in the search: pregnancy, overweight, obesity, family history, parents, childhood, risk factors. Eleven studies of family history and obesity conducted in Europe, Asia, North America, and South America met the inclusion criteria. A meta-analysis of these studies indicated that family history of obesity is a significant risk factor of overweight and /or obesity in offspring; risk for offspring overweight and/or obesity associated with family history varies depending of the family members included in the analysis; and when family history of obesity is present, the offspring are at greater risk for developing obesity or overweight. In addition, the results from moderator analyses suggest that part of the heterogeneity discovered between the studies can be explained by the region of world that the study occurred in and the age of the child at the time of weight assessment.
Abstract: (European) theme parks invest approximately 10 percent of their yearly turnover into new rides and park improvements. Without these investments these parks assume not to be a very competitive and appealing daytrip for their target audiences. However, the impact of investments in attracting new visitors is not well-known and seems to differ dramatically between parks. This paper presents a case study from the Netherlands in which a small amusement park applied a suggested, not yet proven, investment method. The results of the investment are discussed in (a) the form of return on investment and (b) the success of the predictions with regard to this investment. Suggestions for future research are presented.
Abstract: The concept of competitiveness is currently very
frequently used term. However, the interpretation of its essence is
different. In this paper, one of the many concepts of competitiveness
will be analyzed and that is macroeconomic competitiveness, which
is understood as a process, which is based on the productivity growth
through the growth of key macroeconomic indicators such as
standards of living and employment, where all of these variables
must have a sustainable basis. Given the competition is a relative
quantity it must be constantly compared with the development of
competitiveness in other economies or regions. And this comparison
method is also used in the article that compares the macrocompetitiveness
of selected economies of the European Economic
Area – the Czech Republic, Poland, Austria, Switzerland and
Germany. The aim of the paper is to verify the hypothesis concerning
the direct correlation between the size of the economy and its
competitiveness.