Abstract: Amyloid aggregation of polypeptides is related to a
growing number of pathologic states known as amyloid disorders. In
recent years, blocking or reversing amyloid aggregation via the use of
small compounds are considered as two useful approaches in
hampering the development of these diseases. In this research, we
have compared the ability of several manganese-salen derivatives, as
synthetic compounds, and apigenin, as a natural flavonoid, to inhibit
of hen egg-white lysozyme (HEWL) aggregation, as an in vitro
model system.
Different spectroscopic analyses such as Thioflavin T (ThT) and
Anilinonaphthalene-8-sulfonic acid (ANS) fluorescence, Congo red
(CR) absorbance along with transmission electron microscopy were
used in this work to monitor the HEWL aggregation kinetic and
inhibition. Our results demonstrated that both type of compounds
were capable to prevent the formation of lysozyme amyloid
aggregation in vitro. In addition, our data indicated that synthetic
compounds had higher activity to inhibit of the β-sheet structures
relative to natural compound. Regarding the higher antioxidant
activities of the salen derivatives, it can be concluded that in addition
to aromatic rings of each of the compounds, the potent antioxidant
properties of salen derivatives contributes to lower lysozyme fibril
accumulation.
Abstract: Advances in the field of image processing envision a
new era of evaluation techniques and application of procedures in
various different fields. One such field being considered is the
biomedical field for prognosis as well as diagnosis of diseases. This
plethora of methods though provides a wide range of options to select
from, it also proves confusion in selecting the apt process and also in
finding which one is more suitable. Our objective is to use a series of
techniques on bone scans, so as to detect the occurrence of
rheumatoid arthritis (RA) as accurately as possible. Amongst other
techniques existing in the field our proposed system tends to be more
effective as it depends on new methodologies that have been proved
to be better and more consistent than others. Computer aided
diagnosis will provide more accurate and infallible rate of
consistency that will help to improve the efficiency of the system.
The image first undergoes histogram smoothing and specification,
morphing operation, boundary detection by edge following algorithm
and finally image subtraction to determine the presence of
rheumatoid arthritis in a more efficient and effective way. Using preprocessing
noises are removed from images and using segmentation,
region of interest is found and Histogram smoothing is applied for a
specific portion of the images. Gray level co-occurrence matrix
(GLCM) features like Mean, Median, Energy, Correlation, Bone
Mineral Density (BMD) and etc. After finding all the features it
stores in the database. This dataset is trained with inflamed and noninflamed
values and with the help of neural network all the new
images are checked properly for their status and Rough set is
implemented for further reduction.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Search is the most obvious application of information
retrieval. The variety of widely obtainable biomedical data is
enormous and is expanding fast. This expansion makes the existing
techniques are not enough to extract the most interesting patterns
from the collection as per the user requirement. Recent researches are
concentrating more on semantic based searching than the traditional
term based searches. Algorithms for semantic searches are
implemented based on the relations exist between the words of the
documents. Ontologies are used as domain knowledge for identifying
the semantic relations as well as to structure the data for effective
information retrieval. Annotation of data with concepts of ontology is
one of the wide-ranging practices for clustering the documents. In
this paper, indexing based on concept and annotation are proposed
for clustering the biomedical documents. Fuzzy c-means (FCM)
clustering algorithm is used to cluster the documents. The
performances of the proposed methods are analyzed with traditional
term based clustering for PubMed articles in five different diseases
communities. The experimental results show that the proposed
methods outperform the term based fuzzy clustering.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.
Abstract: Regular exercise promotes reduction in blood pressure, reduction in body weight and it also helps to increase in insulin sensitivity. Participation in physical activity should always be linked to medical screening which can reveal serious medical problems. One of them is high blood pressure. Hypertension is risk factor for one billion people worldwide and the highest prevalence is found in Africa. Another component of hypertension is that people who suffer from hypertension have no symptoms. It is estimated that reduction of 3mm Hg in Systolic Blood Pressure decreases cardiac morbidity at least 5%. The most of the guidelines suggest aerobic exercise in a prevention of cardiovascular diseases. On the other hand, it is important to emphasize the impact of resistance training. Even, it was found higher effect for reduction on the level of systolic blood pressure than aerobic exercise.
Abstract: Because of the outbreak of mad cow disease and bird flu, consumers have become more concerned with quality and safety of meat and poultry. As a consequence, meat traceability has been implemented as a tool to raise the standard in the meat production industry. In Thailand, while traceability is relatively common among the manufacturer-wholesaler-retailers cycle, it is rarely used as a marketing tool specifically designed to persuade consumers who are the actual meat endusers. Therefore, the present study attempts to understand what influences consumers to spread their words-of-mouth (WOM) regarding meat with traceability by conducting a study in Thailand where research in this area is rather scant. Data were collected from one hundred and sixty-seven consumers in the northeastern region and analyzed with SEM. The study results reveal that perceived usefulness of traceability system, social norms, and product class knowledge are significant antecedents where consumers spread positive words regarding meat with traceability system. A number of theoretical and managerial implications as well as future study directions are offered at the end of this study report.
Abstract: The inhibition of SH2 domain regulated protein-protein interactions is an attractive target for developing an effective chemotherapeutic approach in the treatment of disease. Molecular simulation is a useful tool for developing new drugs and for studying molecular recognition. In this study, we searched potential drug compounds for the inhibition of SH2 domain by performing structural similarity search in PubChem Compound Database. A total of 37 compounds were screened from the database, and then we used the LibDock docking program to evaluate the inhibition effect. The best three compounds (AP22408, CID 71463546 and CID 9917321) were chosen for MD simulations after the LibDock docking. Our results show that the compound CID 9917321 can produce a more stable protein-ligand complex compared to other two currently known inhibitors of Src SH2 domain. The compound CID 9917321 may be useful for the inhibition of SH2 domain based on these computational results. Subsequently experiments are needed to verify the effect of compound CID 9917321 on the SH2 domain in the future studies.
Abstract: Celiac disease is a permanent enteropathy caused by the ingestion of gluten, a protein occurring in wheat, rye and barley. The only way of the effective daily treatment is a strict gluten-free diet. From the investigation of products available in the local market, it was found that Latvian producers do not offer gluten-free products. The aim of this research was to study and analyze changes of celiac patient’s attitude to gluten-free product quality and availability in the Latvian market and purchasing habits. The survey was designed using website www.visidati.lv, and a questionnaire was sent to people suffering from celiac disease. The first time the respondents were asked to fill in the questionnaire in 2011, but now repeatedly from the beginning of September 2013 till the end of January 2014. The questionnaire was performed with 75 celiac patients, respondents were from all Latvian regions and they answered 16 questions. One of the most important questions was aimed to find out consumers’ opinion about quality of gluten-free products, consumption patterns of gluten-free products, and, moreover, their interest in products made in Latvia. Respondents were asked to name gluten-free products they mainly buy and give specific purchase locations, evaluate the quality of products and necessity for products produced in Latvia. The results of questionnaire show that the consumers are satisfied with the quality of gluten-free flour, flour blends, sweets and pasta, but are not satisfied with the quality of bread and confectionery available in the Latvian markets.
Abstract: Nowadays spinal deformities are very frequent
problems among teenagers. Scheuermann disease is a one
dimensional deformity of the spine, but it has prevalence over 11% of
the children. A traditional technology, the moiré method was used by
us for screening and diagnosing this type of spinal deformity. A
LabVIEW program has been developed to evaluate the moiré pictures
of patients with Scheuermann disease. Two different solutions were
tested in this computer program, the extreme and the inflexion point
calculation methods. Effects using these methods were compared and
according to the results both solutions seemed to be appropriate.
Statistical results showed better efficiency in case of the extreme
search method where the average difference was only 6,09⁰.
Abstract: At present, it is widely-known that free radicals are the causes of illness such as cancers, coronary heart disease, Alzheimer’s disease and aging. One method of protection from free radical is the consumption of antioxidant-containing foods or herbs. Several analytical methods have been used for qualitative and quantitative determination of antioxidants. This project aimed to evaluate antioxidant activity of ethanolic and aqueous extracts from cabbage (Brassicca oleracea L. var. capitata L.) measured by DPPH and Hydroxyl radical scavenging method. The results show that averaged antioxidant activity measured in ethanolic extract (µmol Ascorbic acid equivalent/g fresh mass) were 7.316 ± 0.715 and 4.66 ± 1.029 as determined by DPPH and Hydroxyl radical scavenging activity assays respectively. Averaged antioxidant activity measured in aqueous extract (µmol Ascorbic acid equivalent/g fresh mass) were 15.141 ± 2.092 and 4.955 ± 1.975 as determined by DPPH and Hydroxyl radical scavenging activity assays respectively.
Abstract: Some properties of Intuitionistic Fuzzy (IF) rough relational algebraic operators under an IF rough relational data model are investigated and illustrated using diabetes and heart disease databases. These properties are important and desirable for processing queries in an effective and efficient manner.
Abstract: Muscid flies are known to be vectors of disease agents and species that annoy humans and domesticated animals. An example of these flies is Musca domestica (house fly) whose adult and immature stages occur in a variety of filthy organic substances including household garbage and animal manures. They contribute to microbial contamination of foods. It is therefore imperative to control these flies as a result of their role in Public health. The second and third instars of Musca domestica (Linn) were infected with varying cell loads of Bacillus subtilis in vitro for a period of 48 hours to evaluate its larvicidal activities. Mortality of the larvae increased with incubation period after treatment with the varying cell loads. Investigation revealed that the second instars larvae were more susceptible to treatment than the third instars treatments. Values obtained from the third instar group were significantly different (P
Abstract: A group of 10 dogs (group A) with Periodontal Disease in the third stage, were subjected to regenerative therapy of periodontal tissues, by use of nano hydroxy apatite (NHA). These animals induced by general anesthesia, where treated by ultrasonic scaling, root planning, and at the end by a mucogingival flap in which it was applied NHA. The flap was closed and sutured with simple steps. Another group of 10 dogs (group B), control group, was treated only by scaling and root planning. No patient was subjected to antibiotic therapy. After three months, a check was made by inspection of the oral cavity, radiography and bone biopsy at the alveolar level. Group A showed a total restitutio ad integrum of the periodontal structures, and in group B still mild gingivitis in 70% of cases and 30% of the state remains unchanged. Numerous experimental studies both in animals and humans have documented that the grafts of porous hydroxyapatite are rapidly invaded by fibrovascular tissue which is subsequently converted into mature lamellar bone tissue by activating osteoblast. Since we acted on the removal of necrotic cementum and rehabilitating the root tissue by polishing without intervention in the ligament but only on anatomical functional interface of cement-blasts, we can connect the positive evolution of the clinical-only component of the cement that could represent this perspective, the only reason that Periodontal Disease become a Cement Disease, while all other clinical elements as nothing more than a clinical pathological accompanying.
Abstract: Free radicals are atoms or molecules with unpaired electrons. Many diseases are caused by free radicals. Normally, free radical formation is controlled naturally by various beneficial compounds known as antioxidants. Several analytical methods have been used for qualitative and quantitative determination of antioxidants, and each has its own specificity. This project aimed to evaluate antioxidant activity of ethanolic and aqueous extracts from the rice paddy herb (Limnophila aromatica (Lam.) Merr.) measured by DPPH and Hydroxyl radical scavenging method. The results showed that averaged antioxidant activity measured in ethanolic extract (µmol Ascorbic acid equivalent/g fresh mass) were 67.09± 4.99 and 15.55±4.82 as determined by DPPH and Hydroxyl radical scavenging activity assays, respectively. Averaged antioxidant activity measured in aqueous extract (µmol Ascorbic acid equivalent/g fresh mass) were 21.08±1.25 and 10.14±3.94 as determined by DPPH and Hydroxyl radical scavenging activity assays respectively.
Abstract: The procedure for the assessment of the urinary mucosal cryoglobulin (UMCG) is being reviewed, testified and evaluated. The major features of UMCG are rather similar to that of serum cryoglobulin. Such evident similarities are forming the reality for the existence of the UMCG. There were seven characterizing criteria useable for the identification for UMCG. Upon matching them to the Irish criteria for serum cryoglobulin, some modifications are being proposed to the 16th standards that has been formulated and built as an Irish criteria. The existence of UMCG is being reported for the first time in human chronic infectious bacterial disease.
Abstract: Diabetic retinopathy is characterized by the development of retinal microaneurysms. The damage can be prevented if disease is treated in its early stages. In this paper, we are comparing Support Vector Machine (SVM) and Naïve Bayes (NB) classifiers for automatic microaneurysm detection in images acquired through non-dilated pupils. The Nearest Neighbor classifier is used as a baseline for comparison. Detected microaneurysms are validated with expert ophthalmologists’ hand-drawn ground-truths. The sensitivity, specificity, precision and accuracy of each method are also compared.
Abstract: Mastitis is one of the most economic disease affecting dairy cows worldwide. Its classic diagnosis using bacterial culture and biochemical findings is a difficult and prolonged method. In this research, using of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) permitted identification of different microorganisms with high accuracy and rapidity (only 24 hours for microbial growth and analysis). During the application of MALDI-TOF MS, one hundred twenty strains of Staphylococcus and Streptococcus species isolated from milk of cows affected by clinical and subclinical mastitis were identified, and the results were compared with those obtained by traditional methods as API and VITEK 2 Systems. 37 of totality 39 strains (~95%) of Staphylococcus aureus (S. aureus) were exactly detected by MALDI TOF MS and then confirmed by a nuc-based PCR technique, whereas accurate identification was observed in 100% (50 isolates) of the coagulase negative staphylococci (CNS) and Streptococcus agalactiae (31 isolates). In brief, our results demonstrated that MALDI-TOF MS is a fast and truthful technique which has the capability to replace conventional identification of several bacterial strains usually isolated in clinical laboratories of microbiology.