Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The dry-storage systems of nuclear power plants (NPPs) in Taiwan have become one of the major safety concerns. There are two steps considered in this study. The first step is the verification of the TRACE by using VSC-17 experimental data. The results of TRACE were similar to the VSC-17 data. It indicates that TRACE has the respectable accuracy in the simulation and analysis of the dry-storage systems. The next step is the application of TRACE in the dry-storage system of Kuosheng NPP (BWR/6). Kuosheng NPP is the second BWR NPP of Taiwan Power Company. In order to solve the storage of the spent fuels, Taiwan Power Company developed the new dry-storage system for Kuosheng NPP. In this step, the dry-storage system model of Kuosheng NPP was established by TRACE. Then, the steady state simulation of this model was performed and the results of TRACE were compared with the Kuosheng NPP data. Finally, this model was used to perform the safety analysis of Kuosheng NPP dry-storage system. Besides, FRAPTRAN was used tocalculate the transient performance of fuel rods.
Abstract: In review the generalized data about different methods of synthesis of biological activity acylatedhydrohyanthraquinones is presented. The basic regularity of a synthesis is analyzed. Action of temperature, pH, solubility, catalysts and other factors on a reaction product yield is revealed.
Abstract: This article deals with the possibility of increasing efficiency, reliability and safety of the system for teledosimetric data collection management and their evaluation as a part of complex study for activity “Research of data collection, their measurement and evaluation with mobile and autonomous units” within project “Research of monitoring and evaluation of non-standard conditions in the area of nuclear power plants”. Possible weaknesses in existing system are identified. A study of available cluster solutions with possibility of their deploying to analysed system is presented
Abstract: Mastitis is one of the most economic disease affecting dairy cows worldwide. Its classic diagnosis using bacterial culture and biochemical findings is a difficult and prolonged method. In this research, using of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) permitted identification of different microorganisms with high accuracy and rapidity (only 24 hours for microbial growth and analysis). During the application of MALDI-TOF MS, one hundred twenty strains of Staphylococcus and Streptococcus species isolated from milk of cows affected by clinical and subclinical mastitis were identified, and the results were compared with those obtained by traditional methods as API and VITEK 2 Systems. 37 of totality 39 strains (~95%) of Staphylococcus aureus (S. aureus) were exactly detected by MALDI TOF MS and then confirmed by a nuc-based PCR technique, whereas accurate identification was observed in 100% (50 isolates) of the coagulase negative staphylococci (CNS) and Streptococcus agalactiae (31 isolates). In brief, our results demonstrated that MALDI-TOF MS is a fast and truthful technique which has the capability to replace conventional identification of several bacterial strains usually isolated in clinical laboratories of microbiology.
Abstract: In order to investigate the properties of coral reef origin secondary aerosol and especially the contribution of secondary organic aerosol, ethanol affinity to atmospheric nucleation mode particles (diameter
Abstract: Due to climate warming and consequently due to ice and snow melting of the Arctic Ocean, the highly biologically active ocean surface area has been expanding quickly making possible longer marine biota growth seasons during polar summers. That increase the probability of the remote marine environment secondary contribution, especially secondary organic contribution, to the particle production and particle growth events and particle properties, consequently effecting on the open ocean, pack ice and ground based regions radiation budget and thus on the feedbacks between arctic biota, particles, clouds, and climate.
Abstract: This paper focuses on assessing sloshing-induced overflow of the seismically-isolated nuclear tanks based on Fluid-Structure Interaction (FSI) analysis. Typically, fluid motion in the seismically-isolated nuclear tank systems may be rather amplified and even overflowed under earthquake. Sloshing-induced overflow in those structures has to be reliably assessed and predicted since it can often cause critical damages to humans and environments. FSI analysis is herein performed to compute the total cumulative overflowed water volume more accurately, by coupling ANSYS with CFX for structural and fluid analyses, respectively. The approach is illustrated on a nuclear liquid storage tank, Spent Fuel Pool (SFP), forgiven conditions under consideration: different liquid levels, Peak Ground Accelerations (PGAs), and post earthquakes.
Abstract: Flow coastdown phenomena are very important to secure nuclear fuel integrity during loss of off-site power accidents. In this study, primary coolant flow coastdown phenomena are investigated for the Jordan Research and Training Reactor (JRTR) using a simulation software package, Modular Modeling System (MMS). Two MMS models are built. The first one is a simple model to investigate the characteristics of the primary coolant pump only. The second one is a model for a simulation of the Primary Coolant System (PCS) loop, in which all the detailed design data of the JRTR PCS system are modeled, including the geometrical arrangement data. The same design data for a PCS pump are used for both models. Coastdown curves obtained from the two models are compared to study the PCS loop coolant inertia effect on a flow coastdown. Results showed that the loop coolant inertia effect is found to be small in the JRTR PCS loop, i.e., about one second increases in a coastdown half time required to halve the coolant flow rate. The effects of different flywheel inertia on the flow coastdown are also investigated. It is demonstrated that the coastdown half time increases with the flywheel inertia linearly. The designed coastdown half time is proved to be well above the design requirement for the fuel integrity.
Abstract: Soil contamination with radiocesium has a long-term radiological impact due to its long physical half-life (30.1 years for 137Cs and 2 years for 134Cs) and its high biological availability. 137Cs causes the largest concerns because of its deleterious effect on agriculture and stock farming, and, thus, human life for decades. One of the important aspects of the problem of contaminated soils remediation is understand of protective actions aimed at the reduction of biological migration of radionuclides in soil-plant system. The most effective way to bind radionuclides is the use of selective sorbents. The proposed research mainly aims to achieve control on transfer of 137Cs in a system growing media – plant due to counter ions variation in the polymeric sorbents. As research object Japanese basil - Perilla frutescens was chosen. Productivity of plants depending on the presence (control-without presence of polymer) and type of polymer material, as well as content of 137Cs in plant material has been determined. The character of different polymers influences on the 137Cs migration in growing media – plant system as well as accumulation in the plants has been cleared up.
Abstract: Radioactive waste management is fundamental to safeguard population and environment by radiological risks. Environmental assessment of a site, where nuclear activities are located, allows understanding the hydro geological system and the radionuclides transport in groundwater and subsoil. Use of dedicated software is the basis of transport phenomena investigation and for dynamic scenarios prediction; this permits to understand the evolution of accidental contamination events, but at the same time the potentiality of the software itself can be verified. The aim of this paper is to perform a numerical analysis by means of HYDRUS 1D code, so as to evaluate radionuclides transport in a nuclear site in Piedmont region (Italy). In particular, the behavior in vadose zone was investigated. An iterative assessment process was performed for risk assessment of radioactive contamination. The analysis therein developed considers the following aspects: i) hydro geological site characterization; ii) individuation of the main intrinsic and external site factors influencing water flow and radionuclides transport phenomena; iii) software potential for radionuclides leakage simulation purposes.
Abstract: This work is developed within IAEA Coordinated Research Program 1496, “Innovative methods in research reactor analysis: Benchmark against experimental data on neutronics and thermal-hydraulic computational methods and tools for operation and safety analysis of research reactors”.
The study investigates the capability of Code RELAP5/Mod3.4 to solve complex geometry complexity. Its results are compared to the results of PARET, a common code in thermal hydraulic analysis for research reactors, belonging to MTR-PC groups.
The WWR-SM reactor at the Institute of Nuclear Physics (INP) in the Republic of Uzbekistan is simulated using both PARET and RELAP5 at steady state. Results from the two codes are compared.
REALP5 code succeeded in solving the complex fuel geometry. The PARET code needed some calculations to obtain the final result. Although the final results from the PARET are more accurate, the small differences in both results makes using RELAP5 code recommended in case of complex fuel assemblies.
Abstract: The in-depth understanding of severe accident propagation in Generation IV of nuclear reactors is important so that appropriate risk management can be undertaken early in their design process. This paper is focused on model improvements in the SIMMER code in order to perform studies of severe accident mitigation of Sodium Fast Reactor. During the design process of the mitigation devices dedicated to extraction of molten fuel from the core region, the molten fuel propagation from the core up to the core catcher has to be studied. In this aim, analytical as well as the complex thermohydraulic simulations with SIMMER-III code are performed. The studies presented in this paper focus on physical phenomena and associated physical models that influence the corium relocation. Firstly, the molten pool heat exchange with surrounding structures is analyzed since it influences directly the instant of rupture of the dedicated tubes favoring the corium relocation for mitigation purpose. After the corium penetration into mitigation tubes, the fuel-coolant interactions result in formation of debris bed. Analyses of debris bed fluidization as well as sinking into a fluid are presented in this paper.
Abstract: In this work, the main problem considered is the
detection and the isolation of the actuator fault. A new formulation of
the linear system is generated to obtain the conditions of the actuator
fault diagnosis. The proposed method is based on the representation
of the actuator as a subsystem connected with the process system in
cascade manner. The designed formulation is generated to obtain the
conditions of the actuator fault detection and isolation. Detectability
conditions are expressed in terms of the invertibility notions. An
example and a comparative analysis with the classic formulation
illustrate the performances of such approach for simple actuator fault
diagnosis by using the linear model of nuclear reactor.
Abstract: The main aim of the current work is to examine if 14N
is candidate to be clusterized nuclei or not. In order to check this
attendance, we have measured the angular distributions for 14N ion
beam elastically scattered on 12C target nuclei at different low
energies; 17.5, 21, and 24.5MeV which are close to the Coulomb
barrier energy for 14N+12C nuclear system. Study of various transfer
reactions could provide us with useful information about the
attendance of nuclei to be in a composite form (core + valence). The
experimental data were analyzed using two approaches;
Phenomenological (Optical Potential) and semi-microscopic (Double
Folding Potential). The agreement between the experimental data and
the theoretical predictions is fairly good in the whole angular range.
Abstract: MicroRNAs (miRNAs), a class of approximately 22 nucleotide long non coding RNAs which play critical role in different biological processes. The mature microRNA is usually 19–27 nucleotides long and is derived from a bigger precursor that folds into a flawed stem-loop structure. Mature micro RNAs are involved in many cellular processes that encompass development, proliferation, stress response, apoptosis, and fat metabolism by gene regulation. Resent finding reveals that certain viruses encode their own miRNA that processed by cellular RNAi machinery. In recent research indicate that cellular microRNA can target the genetic material of invading viruses. Cellular microRNA can be used in the virus life cycle; either to up regulate or down regulate viral gene expression Computational tools use in miRNA target prediction has been changing drastically in recent years. Many of the methods have been made available on the web and can be used by experimental researcher and scientist without expert knowledge of bioinformatics. With the development and ease of use of genomic technologies and computational tools in the field of microRNA biology has superior tremendously over the previous decade. This review attempts to give an overview over the genome wide approaches that have allow for the discovery of new miRNAs and development of new miRNA target prediction tools and databases.
Abstract: A failure of the non-structural component can cause significant damages in critical facilities such as nuclear power plants and hospitals. Historically, it was reported that the damage from the leakage of sprinkler systems, resulted in the shutdown of hospitals for several weeks by the 1971 San Fernando and 1994 North Ridge earthquakes. In most cases, water leakages were observed at the cross joints, sprinkler heads, and T-joint connections in piping systems during and after the seismic events. Hence, the primary objective of this study was to understand the seismic performance of T-joint connections and to develop an analytical Finite Element (FE) model for the T-joint systems of 2-inch fire protection piping system in hospitals subjected to seismic ground motions. In order to evaluate the FE models of the piping systems using OpenSees, two types of materials were used: 1) Steel02 materials and 2) Pinching4 materials. Results of the current study revealed that the nonlinear moment-rotation FE models for the threaded T-joint reconciled well with the experimental results in both FE material models. However, the system-level fragility determined from multiple nonlinear time history analyses at the threaded T-joint was slightly different. The system-level fragility at the T-joint, determined by Pinching4 material was more conservative than that of using Steel02 material in the piping system.
Abstract: In this study, thermo elastic stress analysis is performed on a cylinder made of laminated isotropic materials under thermomechanical loads. Laminated cylinders have many applications such as aerospace, automotive and nuclear plant in the
industry. These cylinders generally performed under thermomechanical loads. Stress and displacement distribution of the laminated cylinders are determined using by analytical method both thermal and mechanical loads. Based on the results, materials combination plays an important role on the stresses distribution along the radius. Variation of the stresses and displacements along the radius are presented as graphs. Calculations program are prepared using MATLAB® by authors.
Abstract: A simple, rapid and non-invasive electromagnetic sensor (C-FAST device) was- patented; for diagnosis of HCV RNA. Aim: To test the validity of the device compared to standard HCV PCR. Subjects and Methods: The first phase was done as pilot in Egypt on 79 participants; the second phase was done in five centers: one center from Egypt, two centers from Pakistan and two centers from India (800, 92 and 113 subjects respectively). The third phase was done nationally as multicenter study on (1600) participants for ensuring its representativeness. Results: When compared to PCR technique, C-FAST device revealed sensitivity 95% to 100%, specificity 95.5% to 100%, PPV 89.5% to 100%, NPV 95% to 100% and positive likelihood ratios 21.8% to 38.5%. Conclusion: It is practical evidence that HCV nucleotides emit electromagnetic signals that can be used for its identification. As compared to PCR, C-FAST is an accurate, valid and non-invasive device.
Abstract: In this study sugarcane field soils with a long history of atrazine application in Chachoengsao and Chonburi provinces have been explored for their potential of atrazine biodegradation. For the atrazine degrading bacteria isolation, the soils used in this study named ACS and ACB were inoculated in MS-medium containing atrazine. Six short rod and gram-negative bacterial isolates, which were able to use this herbicide as a sole source of nitrogen, were isolated and named as ACS1, ACB1, ACB3, ACB4, ACB5 and ACB6. From the 16S rDNA nucleotide sequence analysis, the isolated bacteria ACS1 and ACB4 were identified as Rhizobium sp. with 89.1-98.7% nucleotide identity, ACB1 and ACB5 were identified as Stenotrophomonas sp. with 91.0-92.8% nucleotide identity, whereas ACB3 and ACB6 were Klebsiella sp. with 97.4-97.8% nucleotide identity.