Abstract: A novel new vanadium (IV) complexes incorporating the chelating diamido cyclopentadienyl {ArN(CH2)3NAr)}2-((ηn-Cp)Cp)} (Ar = 2,6-Pri2C6H3)(Cp = C5H5 and n = 1,2,3,4 and 5) have been studied with calculation of the properties of species involved in various of cyclopentadienyl reaction. These were carried out under investigation of density functional theory (DFT) calculation, and comparing together. Other methods, explicitly including electron correlation, are necessary for more accurate calculations; MB3LYP (Becke) (Lee–Yang–Parr) level of theory often being used to obtain more exact results. These complexes were estimated of electronic energy for molecular system, because it accounts for all electron correlation interactions.
The optimised of [V(ArN(CH2)3NAr)2Cl(η5-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) was found to be thermally more stable than others of vanadium cyclopentadienyl. In the meantime the complex [V(ArN(CH2)3NAr)2Cl(η1-Cp)] (Ar = 2,6-Pri2C6H3 and Cp= C5H5) which is showed a low thermal stability in case of the just one carbon of cyclopentadienyl can be insertion with vanadium metal centre. By using Dewar-Chatt-Duncanson model, as a basis of the molecular orbital (MO) analysis and showed the highest occupied molecular orbital (HOMO) and lowest occupied molecular orbital LUMO.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: Intrabody communication (IBC) is a new way of transferring data using human body as a medium. Minute current can travel though human body without any harm. IBC can remove electrical wires for human area network. IBC can be also a secure communication network system unlike wireless networks which can be accessed by anyone with bad intentions. One of the IBC systems is based on frequency shift keying modulation where individual data are transmitted to the external devices for the purpose of secure access such as digital door lock. It was found that the quality of IBC data transmission was heavily dependent on ground configurations of electronic circuits. Reliable IBC transmissions were not possible when both of the transmitter and receiver used batteries as circuit power source. Transmission was reliable when power supplies were used as power source for both transmitting and receiving sites because the common ground was established through the grounds of instruments such as power supply and oscilloscope. This was due to transmission dipole size and the ground effects of floor and AC power line. If one site used battery as power source and the other site used the AC power as circuit power source, transmission was possible.
Abstract: Both knowledge economy and sustainable development are considered key dimensions in the policy action lines of many developed and developing countries. In this context, universities and other higher education institutes have a vital role in developing and sustaining wellbeing communities.
In this paper, the authors’ aim is to address the links between the concepts of innovation and entrepreneurial capacity and knowledge economy, and to utilize the approach of intellectual capital development in building a sustainable knowledge economy.
The paper will contribute to two discourses:
Developing a common understanding of the intersection aspects between the three concepts: Knowledge economy, Innovation and entrepreneurial system, and sustainable development.
Paving the road towards developing an integrated multidimensional framework for sustainable knowledge economy.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Banana pseudo-stem and fruit-bunch-stem are
agricultural residues that can be used for conversion to bio-char, biooil,
and gases by using thermochemical process. The aim of this work
is to characterize banana pseudo-stem and banana fruit-bunch-stem
through proximate analysis, elemental analysis, chemical analysis,
thermo-gravimetric analysis, and heating calorific value. The ash
contents of the banana pseudo-stem and banana fruit-bunch-stem are
11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana
pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf
wt.% respectively. The molecular formulas for banana stem and
banana fruit-bunch-stem are C24H33NO26 and C19H29NO33
respectively. The measured higher heating values of banana pseudostem
and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg
respectively. By chemical analysis, the lignin, cellulose, and
hemicellulose contents in the samples will also be presented. The
feasibility of the banana wastes to be a feedstock for thermochemical
process in comparison with other biomass will be discussed in this
paper.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.
Abstract: This paper increases directivity and gain of Small Planar Dipole Antenna (SPDA) by using Symmetrical Pyramidal Block (SPB) which operates in X band at 11 GHz. The SPB consists four sides; each of which is metamaterial with Epsilon Negative Medium (ENG) and Epsilon Near-Zero (ENZ). The results simulated using the High Frequency Structure Simulator (HFSS) show that the SPB is capable of enhancing directivity and gain for the SPDA with maximum gain of 2.46 dB. The reflection coefficient is -13.7037 dB with narrow beam width.
Abstract: With the increasing popularity of the Internet, online reading has become an essential source for EFL readers. Using strategies to comprehend information on online reading texts play a crucial role in students’ academic success. Metacognitive reading strategies are effective factors that enhance EFL learners reading comprehension. This study aimed at exploring the use of online metacognitive reading strategies by postgraduate Libyan EFL students. Quantitative data was collected using the Survey of Online Reading Strategies (OSORS). The findings revealed that the participants were moderate users of metacognitive online reading strategies. Problem solving strategies were the most frequently reported used strategies, while support reading strategies were the least. The five most and least frequently reported strategies were identified. Based on the findings, some future research recommendations were presented.
Abstract: This research presents the design, fabrication and application of a flavor sensor for an integrated electronic tongue and electronic nose that can allow rapid characterization of multi-component mixtures in a solution. The odor gas and liquid are separated using hydrophobic porous membrane in micro fluidic channel. The sensor uses an array composed of microbeads in micromachined cavities localized on silicon wafer. Sensing occurs via colorimetric and fluorescence changes to receptors and indicator molecules that are attached to termination sites on the polymeric microbeads. As a result, the sensor array system enables simultaneous and near-real-time analyses using small samples and reagent volumes with the capacity to incorporate significant redundancies. One of the key parts of the system is a passive pump driven only by capillary force. The hydrophilic surface of the fluidic structure draws the sample into the sensor array without any moving mechanical parts. Since there is no moving mechanical component in the structure, the size of the fluidic structure can be compact and the fabrication becomes simple when compared to the device including active microfluidic components. These factors should make the proposed system inexpensive to mass-produce, portable and compatible with biomedical applications.
Abstract: To measure or asses any government’s efficiency we need to measure the performance of this government in regards to the quality of the service it provides. Using a technological platform in service provision became a trend and a public demand. It is also a public need to make sure these services are aligned to values and to the whole government’s strategy, vision and goals as well. Providing services using technology tools and channels can enhance the internal business process and also help establish many essential values to government services like transparency and excellence, since in order to establish e-services many standards and policies must be put in place to enable the handing over of decision making to a mature system oriented mechanism. There was no doubt that the Sultanate of Oman wanted to enhance its services and move it towards automation and establishes a smart government as well as links its services to life events. Measuring government efficiency is very essential in achieving social security and economic growth, since it can provide a clear dashboard of all projects and improvements. Based on this data we can improve the strategies and align the country goals to them.
Abstract: This study analyzes the crisis management and image repair strategies during the crisis of Mahidol Wittayanusorn School (MWIT) library burning. The library of this school was burned by a 16-year-old-male student on June 6th, 2010. This student blamed the school that the lesson was difficult, and other students were selfish. Although no one was in the building during the fire, it had caused damage to the building, books and electronic supplies around 130 million bahts (4.4 million USD). This event aroused many discourses arguing about the education system and morality. The strategies which were used during crisis were denial, shift the blame, bolstering, minimization, and uncertainty reduction. The results of using these strategies appeared after the crisis. That was the numbers of new students, who registered for the examination to get into this school in the later years, have remained the same.
Abstract: The purpose of this study is to investigate hedonic online shopping motivations. A qualitative analysis was conducted to explore the factors influencing online hedonic shopping motivations. The results of the study indicate that traditional hedonic values, consisting of social, role, self-gratification, learning trends, pleasure of bargaining, stimulation, diversion, status, and adventure, and dimensions of flow theory, consisting of control, curiosity, enjoyment, and telepresence, exist in the online shopping environment. Two hedonic motivations unique to Internet shopping, privacy and online shopping achievement, were found. It appears that the most important hedonic value to online shoppers is having the choice to interact or not interact with others while shopping on the Internet. This study serves as a basis for the future growth of Internet marketing.
Abstract: Indoor wireless localization systems have played an
important role to enhance context-aware services. Determining the
position of mobile objects in complex indoor environments, such as
those in multi-floor buildings, is very challenging problems. This
paper presents an effective floor estimation algorithm, which can
accurately determine the floor where mobile objects located. The
proposed algorithm is based on the confidence interval of the
summation of online Received Signal Strength (RSS) obtained from
the IEEE 802.15.4 Wireless Sensor Networks (WSN).We compare
the performance of the proposed algorithm with those of other floor
estimation algorithms in literature by conducting a real
implementation of WSN in our facility. The experimental results and
analysis showed that the proposed floor estimation algorithm
outperformed the other algorithms and provided highest percentage
of floor accuracy up to 100% with 95-percent confidence interval.
Abstract: The objective of this study was to investigate the lifelong
effect of in utero nutrition fed at different stages of pregnancy in
Bali cows (n = 40): (U1) without in utero nutrition (0 – parturition,
negative control); (U2) 0 – 90 d of gestation; (U3) 90 - 180 d of
gestation; (U4) 180 d – parturition; and (U5) in utero nutrition along
gestation period (0 d to parturition – positive control) on the growth
performance of the offspring to weaning age. The results indicated
that effect of maternal nutrition on male and female offspring were
particularly indicated by the growth performance of both the male
and female offspring from birth to weaning.
Abstract: Negotiation is a specific form of interaction based on communication in which the parties enter into deliberately, each with clear but different interests or goals and a mutual dependency towards a decision due to be taken at the end of the confrontation. Consequently, negotiation is a complex activity involving many different disciplines from the strategic aspects and the decision making process to the evaluation of alternatives or outcomes and the exchange of information. While gender differences can be considered as one of the most researched topic within negotiation studies, empirical works and theory present many conflicting evidences and results about the role of gender in the process or the outcome. Furthermore, little interest has been shown over gender differences in the definition of what is negotiation, its essence or fundamental elements. Or, as differences exist in practices, it might be essential to study if the starting point of these discrepancies does not come from different considerations about what is negotiation and what will encourage the participants in their strategic decisions. Some recent and promising experiments made with diverse groups show that male and female participants in a common and shared situation barely consider the same way the concepts of power, trust or stakes which are largely considered as the usual driving forces of any negotiation. Furthermore, results from Human Resource self-assessment tests display and confirm considerable differences between individuals regarding essential behavioral dimensions like capacity to improvise and to achieve, aptitude to conciliate or to compete and orientation towards power and group domination which are also part of negotiation skills. Our intention in this paper is to confront these dimensions with negotiation’s usual driving forces in order to build up new paths for further research.