Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: A meta-analysis may be performed using aggregate data (AD) or an individual patient data (IPD). In practice, studies may be available at both IPD and AD level. In this situation, both the IPD and AD should be utilised in order to maximize the available information. Statistical advantages of combining the studies from different level have not been fully explored. This study aims to quantify the statistical benefits of including available IPD when conducting a conventional summary-level meta-analysis. Simulated meta-analysis were used to assess the influence of the levels of data on overall meta-analysis estimates based on IPD-only, AD-only and the combination of IPD and AD (mixed data, MD), under different study scenario. The percentage relative bias (PRB), root mean-square-error (RMSE) and coverage probability were used to assess the efficiency of the overall estimates. The results demonstrate that available IPD should always be included in a conventional meta-analysis using summary level data as they would significantly increased the accuracy of the estimates.On the other hand, if more than 80% of the available data are at IPD level, including the AD does not provide significant differences in terms of accuracy of the estimates. Additionally, combining the IPD and AD has moderating effects on the biasness of the estimates of the treatment effects as the IPD tends to overestimate the treatment effects, while the AD has the tendency to produce underestimated effect estimates. These results may provide some guide in deciding if significant benefit is gained by pooling the two levels of data when conducting meta-analysis.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: This study aim at the influence of college students’ exercise and leisure motivations on the leisure benefits while using the leisure involvement as a moderator. Whereby, the research tools used in this study included the application of leisure motivation scale, leisure involvement scale and leisure benefits scale, and a hierarchical regression analysis was performed by using a questionnaire-based survey, in which, a total of 1,500 copies of questionnaires were administered and 917 valid questionnaires were obtained, achieving a response rate of 61.13%. Research findings explore that leisure involvement has a moderating effect on the relationship between the leisure motivation and leisure benefits.
Abstract: Water is a fundamental attraction in all cultures and among all classes of people,tourists and citizens. It is a favorite location for major tourism initiatives, celebrations and ceremonies. The vitality of any city depends on citizen action to take part in creating the neighborhoods they desire. Waterfront can provide extensive new areas of high quality public open space in parts of the city that are popular venues for social activities and also have the highest land values. Each city must have a character that can be used as a key attraction for the development. The morphology of a waterfront can be identified by both its physical characteristics and the socio-cultural activities that take place in the area. Alexandria has been selected as an area of study because it has a unique character due to its possession of a variety of waterfronts.
This paper aims to set some criteria of successful waterfront development and then through these criteria analyzing the development of the Qaitbay waterfront in the eastern harbor in Alexandria, Egypt. Hence, a comprehensive improvement of the waterfront areas is certainly needed to ensure a successful waterfront development radiated the sense of uniformity and coherence.
Alexandria can benefit from these criteria to develop its urban waterfront in order to preserve and revitalize its unique waterfront character and achieve mixed uses and tourism development.
Abstract: Banana pseudo-stem and fruit-bunch-stem are
agricultural residues that can be used for conversion to bio-char, biooil,
and gases by using thermochemical process. The aim of this work
is to characterize banana pseudo-stem and banana fruit-bunch-stem
through proximate analysis, elemental analysis, chemical analysis,
thermo-gravimetric analysis, and heating calorific value. The ash
contents of the banana pseudo-stem and banana fruit-bunch-stem are
11.0 mf wt.% and 20.6 mf wt.%; while the carbon content of banana
pseudo-stem and fruit-bunch-stem are 37.9 mf wt.% and 35.58 mf
wt.% respectively. The molecular formulas for banana stem and
banana fruit-bunch-stem are C24H33NO26 and C19H29NO33
respectively. The measured higher heating values of banana pseudostem
and banana fruit-bunch-stem are 15.5MJ/kg and 12.7 MJ/kg
respectively. By chemical analysis, the lignin, cellulose, and
hemicellulose contents in the samples will also be presented. The
feasibility of the banana wastes to be a feedstock for thermochemical
process in comparison with other biomass will be discussed in this
paper.
Abstract: Termites have been observed as major pre-colonisation and post-colonisation pest insect of honeybees’ wooden hives in Nigeria. However, pest situation studies in modern beekeeping have been largely directed towards those pests that affect honeybees rather than the biological structure (wood) which houses the honeybees and the influence of seasons on the pests’ activities against the hives. This study, therefore, investigated the influence of seasons on the intensity of hives attacks by termites for 2 years in University of Port Harcourt, Rivers State using visual inspection. The Experimental Apiary was established with 15 Kenyan’s top bar hives made of Triplochiton scleroxylon wood that were strategically placed and observed within the Department of Forestry and Wildlife Management arboretum. The colonies hives consistently showed comparatively lower termite’s infestation levels in the dry season and, consequently, also lower attacks on the colonized hives. The result indicated raining season as a distinct period for more destructive activities of termites on the hives and strongly associated with dryness of the hives. Since previous study and observations have linked colonization with dry season coupled with minimal attacked on colonized hives; the non-colonised hives should be removed from the field at the onset of raining season and returned two weeks prior to dry season to reduce hives degradation by pests.
Abstract: Two new algorithms for nonparametric estimation of errors-in-variables models are proposed. The first algorithm is based on penalized regression spline. The spline is represented as a piecewise-linear function and for each linear portion orthogonal regression is estimated. This algorithm is iterative. The second algorithm involves locally weighted regression estimation. When the independent variable is measured with error such estimation is a complex nonlinear optimization problem. The simulation results have shown the advantage of the second algorithm under the assumption that true smoothing parameters values are known. Nevertheless the use of some indexes of fit to smoothing parameters selection gives the similar results and has an oversmoothing effect.
Abstract: Raphia wine is an important forest product with cultural significance besides its use as medicine and food in southern Nigeria. This work aims to evaluate the profitability of Raphia wine production and marketing in Sapele Local Government Area, Nigeria. Four communities (Sapele, Ogiede, Okuoke and Elume) were randomly selected for data collection via questionnaires among producers and marketers. A total of 50 producers and 34 marketers were randomly selected for interview. Data was analyzed using descriptive statistics, profit margin, multiple regression and rate of returns on investment (RORI). Annual average profit was highest in Okuoke (Producers – N90, 000.00, Marketers - N70, 000.00) and least in Sapele (Producers N50, 000.00, Marketers – N45, 000.00). Calculated RORI for marketers were Elume (40.0%), Okuoke (25.0%), Ogiede (33.3%) and Sapele (50.0%). Regression results showed that location has significant effects (0.000, ρ ≤ 0.05) on profit margins. Male (58.8%) and female (41.2%) invest in Raphia wine marketing, while males (100.0%) dominate production. Results showed that Raphia wine has potentials to generate household income, enhance food security and improve quality of life in rural, semi-urban and urban communities. Improved marketing channels, storage facilities and credit facilities via cooperative groups are recommended for producers and marketers by concerned agencies.
Abstract: There have been a lot of efforts and researches undertaken in developing efficient tools for performing several tasks in data mining. Due to the massive amount of information embedded in huge data warehouses maintained in several domains, the extraction of meaningful pattern is no longer feasible. This issue turns to be more obligatory for developing several tools in data mining. Furthermore the major aspire of data mining software is to build a resourceful predictive or descriptive model for handling large amount of information more efficiently and user friendly. Data mining mainly contracts with excessive collection of data that inflicts huge rigorous computational constraints. These out coming challenges lead to the emergence of powerful data mining technologies. In this survey a diverse collection of data mining tools are exemplified and also contrasted with the salient features and performance behavior of each tool.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: Non-linear FEM calculations are indispensable when important technical information like operating performance of a rubber component is desired. Rubber bumpers built into air-spring structures may undergo large deformations under load, which in itself shows non-linear behavior. The changing contact range between the parts and the incompressibility of the rubber increases this non-linear behavior further. The material characterization of an elastomeric component is also a demanding engineering task. In this paper a comprehensive investigation is introduced including laboratory measurements, mesh density analysis and complex finite element simulations to obtain the load-displacement curve of the chosen rubber bumper. Contact and friction effects are also taken into consideration. The aim of this research is to elaborate a FEM model which is accurate and competitive for a future shape optimization task.
Abstract: Tidal power can play a vital role in integrating as new source of renewable energy to the off-grid power connection in isolated areas, namely Sandwip, in Bangladesh. It can reduce the present energy crisis and improve the social, environmental and economic perspective of Bangladesh. Tidal energy is becoming popular around the world due to its own facilities. The development of any country largely depends on energy sector improvement. Lack of energy sector is because of hampering progress of any country development, and the energy sector will be stable by only depend on sustainable energy sources. Renewable energy having environmental friendly is the only sustainable solution of secure energy system. Bangladesh has a huge potential of tidal power at different locations, but effective measures on this issue have not been considered sincerely. This paper summarizes the current energy scenario, and Bangladesh can produce power approximately 53.19 MW across the country to reduce the growing energy demand utilizing tidal energy as well as it is shown that Sandwip is highly potential place to produce tidal power, which is estimated approximately 16.49 MW by investing only US $10.37 million. Besides this, cost management for tidal power plant has been also discussed.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: Japanese society is experiencing an aging population and declining birth rate along with the popularization of higher education, spread of economic globalization, rapid progress in technical innovation, changes in employment conditions, and emergence of a knowledge-based society. Against this background, interest in career education at Japanese universities has increased in recent years. This paper describes how the government has implemented career education policies in Japan, and introduces the cases of two universities that have successfully linked career education to university education in Japan.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The research on the development of speaking using folk tales based on performance activities aimed to (1) study the development of speaking skill for early- childhood students, and (2) evaluate the development of speaking skill before and after speaking activities. Ten students of Kindergarten level 2, who have enrolled in the subject of the research for speaking development of semester 2 in 2013 were purposively selected as the research cohort. The research tools were lesson plans for speaking activities and pre-post test for speaking development that were approved as content validity and reliability (IOC=.66-1.00,α=0.967). The research found that the development of speaking skill of the research samples before using performance activities on folk tales in developing speaking skill was in the normal high level. Additionally, the results appeared that the preschoolers after applying speaking skill on performance activities also imaginatively created their speaking skill.