Abstract: The biomass-based fuels have become great concern in order to replace the petroleum-based fuels. Biofuels are a wide range of fuels referred to liquid, gas and solid fuels produced from biomass. Recently, higher chain alcohols such as 3-methyl-1-butanol and isobutanol have become a better candidate compared to bioethanol in order to replace gasoline as transportation fuel. Therefore, in this study, 3-methyl-1-butanol was produced through a fermentation process by yeast. Several types of yeast involved in this research including Saccharomyces cerevisiae, Kluyveromyces lactis GG799 and Pichia pastoris (KM71H, GS115 and X33). The result obtained showed that K. lactis GG799 gave the highest concentration of 3-methyl-1-butanol at 274 mg/l followed by S. cerevisiae, P. pastoris GS115, P. pastoris KM71H and P. pastoris X33 at 265 mg/l, 190 mg/l, 182 mg/l and 174 mg/l respectively. Based on the result, it proved that yeast have a potential in producing 3-methyl-1-butanol naturally.
Abstract: In the present work, detailed analysis on flow characteristics of a pair of immiscible liquids through horizontal pipeline is simulated by using ANSYS FLUENT 6.2. Moderately viscous oil and water (viscosity ratio = 107, density ratio = 0.89 and interfacial tension = 0.024 N/m) have been taken as system fluids for the study. Volume of Fluid (VOF) method has been employed by assuming unsteady flow, immiscible liquid pair, constant liquid properties, and co-axial flow. Meshing has been done using GAMBIT. Quadrilateral mesh type has been chosen to account for the surface tension effect more accurately. From the grid independent study, we have selected 47037 number of mesh elements for the entire geometry. Simulation successfully predicts slug, stratified wavy, stratified mixed and annular flow, except dispersion of oil in water, and dispersion of water in oil. Simulation results are validated with horizontal literature data and good conformity is observed. Subsequently, we have simulated the hydrodynamics (viz., velocity profile, area average pressure across a cross section and volume fraction profile along the radius) of stratified wavy and annular flow at different phase velocities. The simulation results show that in the annular flow, total pressure of the mixture decreases with increase in oil velocity due to the fact that pipe cross section is completely wetted with water. Simulated oil volume fraction shows maximum at the centre in core annular flow, whereas, in stratified flow, maximum value appears at upper side of the pipeline. These results are in accord with the actual flow configuration. Our findings could be useful in designing pipeline for transportation of crude oil.
Abstract: In recent years, in addition to face the external threats such as energy shortages and climate change, traffic congestion and environmental pollution have become anxious problems for many cities. Considering private automobile-oriented urban development had produced many negative environmental and social impacts, the transit-oriented development (TOD) has been considered as a sustainable urban model. TOD encourages public transport combined with friendly walking and cycling environment designs, however, non-motorized modes help improving human health, energy saving, and reducing carbon emissions. Due to environmental changes often affect the planners’ decision-making; this research applies dynamic network process (DNP) which includes the time dependent concept to promoting friendly walking and cycling environmental designs as an advanced planning support system for environment improvements.
This research aims to discuss what kinds of design strategies can improve a friendly walking and cycling environment under TOD. First of all, we collate and analyze environment designing factors by reviewing the relevant literatures as well as divide into three aspects of “safety”, “convenience”, and “amenity” from fifteen environment designing factors. Furthermore, we utilize fuzzy Delphi Technique (FDT) expert questionnaire to filter out the more important designing criteria for the study case. Finally, we utilized DNP expert questionnaire to obtain the weights changes at different time points for each design criterion. Based on the changing trends of each criterion weight, we are able to develop appropriate designing strategies as the reference for planners to allocate resources in a dynamic environment. In order to illustrate the approach we propose in this research, Taipei city as one example has been used as an empirical study, and the results are in depth analyzed to explain the application of our proposed approach.
Abstract: Amongst the many priorities facing Libya following the 2011 uprising is the provision of a transport infrastructure that will meet the nation’s needs and not undermine its prospects for economic prosperity as with many developing economies non-technical issues such as management, planning and financing are the major barriers to the efficient and effective provision of transport infrastructure. This is particularly true in the case of the effective incorporation of sustainability criteria, and the research upon which this paper is based involves the examination of alternative ways of approaching this problem. It is probably fair to say that criteria that relate to sustainability have not, historically, featured strongly in Libya’s approach to the development of its transport infrastructure. However, the current reappraisal of how best to redevelop the country’s transport infrastructure that has been afforded by recent events may offer the opportunity to alter this. The research examines recent case studies from a number of countries to explore ways in which sustainability has been included as a criterion for planning and procurement decisions. There will also be an in-depth investigation into the Libyan planning and legislative context to examine the feasibility of the introduction of such sustainability criteria into the process of planning and procurement of Libya’s transport infrastructure.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: Various biomass based resources, which can be used
as an extender, or a complete substitute of diesel fuel may have very
significant role in the development of agriculture, industrial and
transport sectors in the energy crisis. Use of Karanja oil methyl ester
biodiesel in a CI DI engine was found highly compatible with engine
performance along with lower exhaust emission as compared to
diesel fuel but with slightly higher NOx emission and low wear
characteristics. The combustion related properties of vegetable oils
are somewhat similar to diesel oil. Neat vegetable oils or their blends
with diesel, however, pose various long-term problems in
compression ignition engines. These undesirable features of
vegetable oils are because of their inherent properties like high
viscosity, low volatility, and polyunsaturated character. Pongamia
methyl ester (PME) was prepared by transesterification process using
methanol for long term engine operations. The physical and
combustion-related properties of the fuels thus developed were found
to be closer to that of the diesel. A neat biodiesel (PME) was selected
as a fuel for the tribological study of biofuels.
Two similar new engines were completely disassembled and
subjected to dimensioning of various vital moving parts and then
subjected to long-term endurance tests on neat biodiesel and diesel
respectively. After completion of the test, both the engines were
again disassembled for physical inspection and wear measurement of
various vital parts. The lubricating oil samples drawn from both
engines were subjected to atomic absorption spectroscopy (AAS) for
measurement of various wear metal traces present. The additional
lubricating property of biodiesel fuel due to higher viscosity as
compared to diesel fuel resulted in lower wear of moving parts and
thus improved the engine durability with a bio-diesel fuel. Results
reported from AAS tests confirmed substantially lower wear and thus
improved life for biodiesel operated engines.
Abstract: In industrial environments, the heat exchanger is a
necessary component to any strategy of energy conversion. Much of
thermal energy used in industrial processes passes at least one times
by a heat exchanger, and methods systems recovering thermal
energy.
This survey paper tries to presents in a systemic way an sample
control of a heat exchanger by comparison between three controllers
LQR (linear quadratic regulator), PID (proportional, integrator and
derivate) and Pole Placement. All of these controllers are used mainly
in industrial sectors (chemicals, petrochemicals, steel, food
processing, energy production, etc…) of transportation (automotive,
aeronautics), but also in the residential sector and tertiary (heating, air
conditioning, etc...) The choice of a heat exchanger, for a given
application depends on many parameters: field temperature and
pressure of fluids, and physical properties of aggressive fluids,
maintenance and space. It is clear that the fact of having an
exchanger appropriate, well-sized, well made and well used allows
gain efficiency and energy processes.
Abstract: The approach in analyzing defects on different pipe lines is conducted through Failure Assessment Diagram (FAD). These methods of analyses have further extended in recent years. This approach is used to identify and stress out a solution for the defects which randomly occur with gas pipes such are corrosion defects, gauge defects, and combination of defects where gauge and dents are included. Few of the defects are to be analyzed in this paper where our main focus will be the fracture of cast Iron pipes, elastic-plastic failure and plastic collapse of X52 steel pipes for gas transport. We need to conduct a calculation of probability of the defects in order to predict and avoid such costly defects.
Abstract: To avoid battery assisted tags with limited lifetime batteries, it is proposed here to replace them by energy harvesting
systems, able to feed from local environment. This would allow total
independence to RFID systems, very interesting for applications
where tag removal from its location is not possible. Example is here
described for luggage safety in airports, and is easily extendable to similar situation in terms of operation constraints. The idea is to fix
RFID tag with energy harvesting system not only to identify luggage
but also to supply an embedded microcontroller with a sensor
delivering luggage weight making it impossible to add or to remove
anything from the luggage during transit phases. The aim is to
optimize the harvested energy for such RFID applications, and to
study in which limits these applications are theoretically possible.
Proposed energy harvester is based on two energy sources:
piezoelectricity and electromagnetic waves, so that when the luggage
is moving on ground transportation to airline counters, the piezo
module supplies the tag and its microcontroller, while the RF module
operates during luggage transit thanks to readers located along the
way. Tag location on the luggage is analyzed to get best vibrations, as
well as harvester better choice for optimizing the energy supply
depending on applications and the amount of energy harvested during
a period of time. Effects of system parameters (RFID UHF
frequencies, limit distance between the tag and the antenna necessary
to harvest energy, produced voltage and voltage threshold) are
discussed and working conditions for such system are delimited.
Abstract: The author examines modern problems of Russian sport legislation and whether it need to be changed in order to allow all sportsmen to participate, train and have another sportsmen’s rights as Russian law mandates. The article provides an overview of Russian sport legislation problems, provides examples of foreign countries. In addition, the author suggests solutions for existing legal problems.
Abstract: It is widely assumed that the case of Customs Supply Chain is classified as a complex system, due to not only the variety and large number of actors, but also their complex structural links, and the interactions between these actors, that’s why this system is subject to various types of Risks. The economic, political and social impacts of those risks are highly detrimental to countries, businesses and the public, for this reason, Risk management in the customs supply chain is becoming a crucial issue to ensure the sustainability, security and safety. The main characteristic of customs risk management approach is determining which goods and means of transport should be examined? To what extend? And where future compliance resources should be directed? The purposes of this article are, firstly to deal with the concept of customs supply chain, secondly present our risk management approach based on Cross Activity Based Costing (ABC) Method as an interactive tool to support decision making in customs risk management. Finally, analysis of case study of Moroccan customs to putting theory into practice and will thus draw together the various elements of a structured and efficient risk management approach.
Abstract: This article deals with selection standards for national sport teams. The author examines the legal framework for selection criteria and suggests using the most honest criteria.
Abstract: Third-party warehousing logistics has an important role in the development of external logistics. At present, the third-party logistics in our country is still a new industry, the accounting system has not yet been established, the current financial accounting system of third-party warehousing logistics is mainly in the traditional way of thinking, and only able to provide the total cost information of the entire enterprise during the accounting period, unable to reflect operating indirect cost information. In order to solve the problem of third-party logistics industry cost information distortion, improve the level of logistics cost management, the paper combines theoretical research and case analysis method to reflect cost allocation by building third-party logistics costing model using Time-Driven Activity-Based Costing(TDABC), and takes S company as an example to account and control the warehousing logistics cost.Based on the idea of “Products consume activities and activities consume resources”, TDABC put time into the main cost driver and use time-consuming equation resources assigned to cost objects. In S company, the objects focuses on three warehouse, engaged with warehousing and transportation (the second warehouse, transport point) service. These three warehouse respectively including five departments, Business Unit, Production Unit, Settlement Center, Security Department and Equipment Division, the activities in these departments are classified by in-out of storage forecast, in-out of storage or transit and safekeeping work. By computing capacity cost rate, building the time-consuming equation, the paper calculates the final operation cost so as to reveal the real cost.The numerical analysis results show that the TDABC can accurately reflect the cost allocation of service customers and reveal the spare capacity cost of resource center, verifies the feasibility and validity of TDABC in third-party logistics industry cost accounting. It inspires enterprises focus on customer relationship management and reduces idle cost to strengthen the cost management of third-party logistics enterprises.
Abstract: This paper seeks to illustrate the impact of rapid urbanization (in terms of both increase in people and vehicles) in the Gauteng region (which includes Johannesburg, Pretoria and Ekurhuleni). The impact that existing transport systems and options place on the capacity of residents from low income areas to travel and conduct various socio-economic activities is discussed. The findings are drawn from a 2013 analysis of a random transport household survey of 1550 households carried out in Gauteng province. 91.4% of the study respondents had access to public transport, while 8.6% had no access to public transport. Of the 91.4% who used public transport, the main reason used to explain this state of affairs was that it was affordable (54.3%), convenient (15.9%), Accessible (11.9%), lack of alternatives (6.4%) and reliable at 4.1%. Recommendations advanced revolve around the need to reverse land use and transportation effects of apartheid planning, growing and developing a sustainable critical mass of public transport interventions supported by appropriate transport systems that are environmentally sustainable through proper governance. 38.5% of the respondents indicated that developing compact, smart and integrated urban land spaces was key to reducing travel challenges in the study area. 23.4% indicated that the introduction and upgrading of BRT buses to cover all areas in the study area was a step in the right direction because it has great potential in shifting travel patterns to favor public modes of transport. 15.1% indicated that all open spaces should be developed so that fragmentation of land uses can be addressed. This would help to fight disconnected and fragmented space and trip making challenges in Gauteng. 13.4% indicated that improving the metro rail services was critical since this is a mass mover of commuters. 9.6% of the respondents highlighted that the bus subsidy policy has to be retained in the short to medium term since the spatial mismatches and challenges created by apartheid are yet to be fully reversed.
Abstract: One of the major thrusts of the Bus Rapid Transit System is to reduce the commuter’s dependency on private vehicles and increase the shares of public transport to make urban transportation system environmentally sustainable. In this study, commuter mode choice analysis is performed that examines behavioral responses to the proposed Bus Rapid Transit System (BRTS) in Surat, with estimation of the probable shift from private mode to public mode. Further, evaluation of the BRTS scenarios, using Surat’s transportation ecological footprint was done. A multi-modal simulation model was developed in Biogeme environment to explicitly consider private users behaviors and non-linear environmental impact. The data of the different factors (variables) and its impact that might cause modal shift of private mode users to proposed BRTS were collected through home-interview survey using revealed and stated preference approach. A multi modal logit model of mode-choice was then calibrated using the collected data and validated using proposed sample. From this study, a set of perception factors, with reliable and predictable data base, to explain the variation in modal shift behaviour and their impact on Surat’s ecological environment has been identified. A case study of the proposed BRTS connecting the Surat Industrial Hub to the coastal area is provided to illustrate the approach.
Abstract: Hydrological modelling plays a crucial role in the planning and management of water resources, most especially in water stressed regions where the need to effectively manage the available water resources is of critical importance. However, due to the complex, nonlinear and dynamic behaviour of hydro-climatic interactions, achieving reliable modelling of water resource systems and accurate projection of hydrological parameters are extremely challenging. Although a significant number of modelling techniques (process-based and data-driven) have been developed and adopted in that regard, the field of hydrological modelling is still considered as one that has sluggishly progressed over the past decades. This is majorly as a result of the identification of some degree of uncertainty in the methodologies and results of techniques adopted. In recent times, evolutionary computation (EC) techniques have been developed and introduced in response to the search for efficient and reliable means of providing accurate solutions to hydrological related problems. This paper presents a comprehensive review of the underlying principles, methodological needs and applications of a promising evolutionary computation modelling technique – genetic programming (GP). It examines the specific characteristics of the technique which makes it suitable to solving hydrological modelling problems. It discusses the opportunities inherent in the application of GP in water related-studies such as rainfall estimation, rainfall-runoff modelling, streamflow forecasting, sediment transport modelling, water quality modelling and groundwater modelling among others. Furthermore, the means by which such opportunities could be harnessed in the near future are discussed. In all, a case for total embracement of GP and its variants in hydrological modelling studies is made so as to put in place strategies that would translate into achieving meaningful progress as it relates to modelling of water resource systems, and also positively influence decision-making by relevant stakeholders.
Abstract: Diesel vehicle should be equipped with emission after-treatment devices as NOx reduction catalyst and particulate filtersin order to meet more stringer diesel emission standard. Urea-SCR is being developed as the most efficient method of reducing NOx emissions in the after-treatment devices of diesel engines, and recent studies have begun to mount the Urea-SCR device for diesel passenger cars and light duty vehicles. In the present study, the effects of the mixer on the efficiency of urea-SCR System (i.e., NH3uni- formityindex (NH3 UI) is investigated by predicting the transport phenomena in the urea-SCR system. The three dimensional Eulerian-Lagrangian CFD simulationfor internal flow and spray characteristics in front of SCR is carried out by using STAR-CCM+ 7.06 code. In addition, the paper proposes a method to minimize the wall-wetting around the urea injector in order to prevent injector blocks caused by solid urea loading.
Abstract: The demand for efficient transonic transport has been growing every day and may turn out to be the most pressed innovation in coming years. Oblique wing configuration was proposed as an alternative to conventional wing configuration for supersonic and transonic passenger aircraft due to its aerodynamic advantages. This paper re-demonstrates the aerodynamic advantages of oblique wing configuration using open source CFD code. The aerodynamic data were generated using Panel Method. Results show that Oblique Wing concept with elliptical wing planform offers a significant reduction in drag at transonic and supersonic speeds and approximately twice the lift distribution compared to conventional operating aircrafts. The paper also presents a preliminary conceptual aircraft sizing which can be used for further experimental analysis.
Abstract: Autonomous mobile robots can be found in a wide
field of applications. Their types range from household robots over
workshop robots to autonomous cars and many more. All of them
undergo a number of testing steps during development, production
and maintenance. This paper describes an approach to improve
testing of robot behavior. It was inspired by the RoboCup @work
competition that itself reflects a robotics benchmark for industrial
robotics. There, scaled down versions of mobile industrial robots
have to navigate through a workshop-like environment or operation
area and have to perform tasks of manipulating and transporting
work pieces. This paper will introduce an approach of automated
vision-based testing of the behavior of the so called youBot robot,
which is the most widely used robot platform in the RoboCup
@work competition. The proposed system allows automated testing
of multiple tries of the robot to perform a specific missions and
it allows for the flexibility of the robot, e.g. selecting different
paths between two tasks within a mission. The approach is based
on a multi-camera setup using, off the shelf cameras and optical
markers. It has been applied for test-driven development (TDD) and
maintenance-like verification of the robot behavior and performance.
Abstract: Implicit in most large-scale numerical analyses of the crystal growth from the melt is the assumption that the shape and position of the phase boundary are determined by the transport phenomena coupled strongly to the melt hydrodynamics. In the present numerical study, the interface shape-effect on the convective interactions in a Czochralski oxide melt is described. It was demonstrated that thermocapillary flow affects inversely the phase boundaries of distinct shapes. The inhomogenity of heat flux and the location of the stagnation point at the crystallization front were investigated. The forced convection effect on the point displacement at the boundary found to be much stronger for the flat plate interface compared to the cone-shaped one with and without the Marangoni flow.