Abstract: The work presented in this paper was performed for a workstation of an assembly section in a company that manufactures radio modules and air conditioning for cars. After performing a workstation analysis and a questionnaire to the operators it was possible to understand the need to investigate the risk of musculoskeletal disorders originated from both the handling of loads as the incorrect dimensioning of the workstation. Regarding the handling of loads the NIOSH Equation was used and it was verified that there was no risk of musculoskeletal disorders. As the operators expressed their lack of satisfaction regarding back pains due to posture adopted they were established the appropriate dimensions (to satisfy 97.5% of the population and using the table of anthropometric data of the Portuguese population) for the workstation and it was proposed the availability of a chair for the workers.
Abstract: As a developing country, The Kingdom of Saudi Arabia (KSA) needs to make the best possible use of its workforce for social and economic reasons. The workforce is diverse, calling for appropriate diversity management (DM). The thesis focuses on the banking sector in KSA. To date, there have been no studies on DM in the banking sector in this country. Many organizations have introduced specific policies and programmes to improve the recruitment, inclusion, promotion, and retention of diverse employees, in addition to the legal requirements existing in many countries. However, Western-centric models of DM may not be applicable, at least not in their entirety, in other regions.
The aim of the study is to devise a framework for understanding gender, age and disability DM in the banking sector in KSA in order to enhance DM in this sector. A sample of 24 managers, 2 from each of the 12 banks, was interviewed to obtain their views on DM in the banking sector in KSA. Thematic analysis was used to analyze the data. These themes were used to develop the questionnaire, which was administered to 10 managers in each of the 12 banks. After analysis of these data, and completion of the study, the research will make a theoretical contribution to the knowledge on DM and a practical contribution to the management of diversity in Saudi banks. This paper concerns a work in progress.
Abstract: In this study, Electrical Discharge Machining (EDM) is used to modify the surface of high carbon steel En31 with the help of tool electrode (Copper-Chromium-Nickel) manufactured by powder metallurgy (PM) process. The effect of EDM on surface roughness during surface alloying is studied. Taguchi’s Design of experiment (DOE) and L18 orthogonal array is used to find the best level of input parameters in order to achieve high surface finish. Six input parameters are considered and their percentage contribution towards surface roughness is investigated by analysis of variances (ANOVA). Experimental results show that an hard alloyed surface (1.21% carbon, 2.14% chromium and 1.38% nickel) with surface roughness of 3.19µm can be generated using EDM with PM tool. Additionally, techniques like Scanning Electron Microscope (SEM) and Energy Dispersive Spectroscopy (EDS) are used to analyze the machined surface and EDMed layer composition, respectively. The increase in machined surface micro-hardness (101%) may be related to the formation of carbides containing chromium.
Abstract: Solid lipid nanoparticles (SLNs) have gained great attention for the topical treatment of skin associated fungal infection as they facilitate the skin penetration of loaded drugs. Our work deals with the preparation of nystatin loaded solid lipid nanoparticles (NystSLNs) using the hot homogenization and ultrasonication method. The prepared NystSLNs were characterized in terms of entrapment efficiency, particle size, zeta potential, transmission electron microscopy, differential scanning calorimetry, rheological behavior and in vitro drug release. A stability study for 6 months was performed. A microbiological study was conducted in male rats infected with Candida albicans, by counting the colonies and examining the histopathological changes induced on the skin of infected rats. The results showed that SLNs dispersions are spherical in shape with particle size ranging from 83.26±11.33 to 955.04±1.09 nm. The entrapment efficiencies are ranging from 19.73±1.21 to 72.46±0.66% with zeta potential ranging from -18.9 to -38.8 mV and shear-thinning rheological Behavior. The stability studies done for 6 months showed that nystatin (Nyst) is a good candidate for topical SLN formulations. A least number of colony forming unit/ ml (cfu/ml) was recorded for the selected NystSLN compared to the drug solution and the commercial Nystatin® cream present in the market. It can be fulfilled from this work that SLNs provide a good skin targeting effect and may represent promising carrier for topical delivery of Nyst offering the sustained release and maintaining the localized effect, resulting in an effective treatment of cutaneous fungal infection.
Abstract: Generally, distributed generation units refer to small-scale electric power generators that produce electricity at a site close to the customer or an electric distribution system (in parallel mode). From the customers’ point of view, a potentially lower cost, higher service reliability, high power quality, increased energy efficiency, and energy independence can be the key points of a proper DG unit. Moreover, the use of renewable types of distributed generations such as wind, photovoltaic, geothermal or hydroelectric power can also provide significant environmental benefits. Therefore, it is of crucial importance to study their impacts on the distribution networks. A marked increase in Distributed Generation (DG), associated with medium voltage distribution networks, may be expected. Nowadays, distribution networks are planned for unidirectional power flows that are peculiar to passive systems, and voltage control is carried out exclusively by varying the tap position of the HV/MV transformer. This paper will compare different DG control methods and possible network reconfiguration aimed at assessing their effect on voltage profiles.
Abstract: This research aims to critical analyze the feminine violent within Thai daily newspaper. This study was qualitative base; content analysis from two popular newspapers (Thairath and Dailynews) two qualitative newspapers (Thaipost and Mathichon). Purposive sampling was used to select eleven specialize news reporters to do in-depth interview. The result found that, popular newspapers, Thairath and dailynews have presented feminine violent news in their paper more than Thaipost and Mathichon the qualitative newspaper. Beside, majority of sample present the feminine violent within news under the code of ethic, The National Press Council of Thailand. Interesting, the age of feminine violent victim was the information that has been focused most. The popular newspaper have illustrated crime scene photo on their first-page while qualitative newspaper used only headline to present the same news.
Abstract: Many organizations are opting to adopt Open Source Software (OSS) as it is the current trend to rely on each other rather than on companies (Software vendors). It is a clear shift from organizations to individuals, the concept being to rely on collective participation rather than companies/vendors.
The main objectives of this research are 1) to identify the current level of OSS usage in Sultan Qaboos University; 2) to identify the potential benefits of using OSS in educational institutes; 3) to identify the OSS applications that are most likely to be used within an educational institute; 4) to identify the existing and potential barriers to the successful adoption of OSS in education.
To achieve these objectives a two-stage research method was conducted. First a rigorous literature review of previously published material was performed (interpretive/descriptive approach), and then a set of interviews were conducted with the IT professionals at Sultan Qaboos University in Oman in order to explore the extent and nature of their usage of OSS.
Abstract: The rapid development and growth of technology has changed the method of obtaining information for educators and learners. Technology has created a new world of collaboration and communication among people. Incorporating new technology into the teaching process can enhance learning outcomes. Billions of individuals across the world are now connected together, and are cooperating and contributing their knowledge and intelligence. Time is no longer wasted in waiting until the teacher is ready to share information as learners can go online and get it immediatelt.
The objectives of this paper are to understand the reasons why changes in teaching and learning methods are necessary, to find ways of improving them, and to investigate the challenges that present themselves in the adoption of new ICT tools in higher education institutes.
To achieve these objectives two primary research methods were used: questionnaires, which were distributed among students at higher educational institutes and multiple interviews with faculty members (teachers) from different colleges and universities, which were conducted to find out why teaching and learning methodology should change.
The findings show that both learners and educators agree that educational technology plays a significant role in enhancing instructors’ teaching style and students’ overall learning experience; however, time constraints, privacy issues, and not being provided with enough up-to-date technology do create some challenges.
Abstract: Since women obtained the right to vote in 1893 for the first time in New Zealand, they have tried to participate actively into politics but still the world has a few women in political leadership. The article asks which factors might influence the appearance of women leadership in politics. The article investigates two factors such as political context, personal factors. Countries where economic development is stable and political democracy is consolidated have a tendency of appearance of women political leadership but in less developed and politically unstable countries, women politicians can be in power with their own reasons. For the personal factor, their feminist propensity is studied but there is no relationship between the appearance of women leaders and their feminist propensity.
Abstract: The extracellular proteins secreted by bacteria may be increased in stressful surroundings, such as in the presence of antibiotics. It appears that many antibiotics, when used at low concentrations, have in common the ability to activate or repress gene transcription, which is distinct from their inhibitory effect. There have been comparatively few studies on the potential of antibiotics as a specific chemical signal that can trigger a variety of biological functions. Therefore, this study was carried out to determine the effect of Streptomycin Sulfate in regulating extracellular proteins secreted by Bacillus subtilis ATCC21332. Results of Microdilution assay showed that the Minimum Inhibition Concentration (MIC) of Streptomycin Sulfate on B. subtilis ATCC21332 was 2.5 mg/ml. The bacteria cells were then exposed to Streptomycin Sulfate at concentration of 0.01 MIC before being further incubated for 48h to 72 h. The extracellular proteins secreted were then isolated and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins profile revealed that three additional bands with approximate sizes of 30 kDa, 22 kDa and 23 kDa were appeared for the treated bacteria with Streptomycin Sulfate. Thus, B. subtilis ATCC21332 in stressful condition with the presence of Streptomycin Sulfate at low concentration could induce the extracellular proteins secretion.
Abstract: Ferulic acid has widespread industrial potential by virtue of its antioxidant properties. However, it is partially soluble in aqueous media, limiting their usefulness in oil-based processes in food, cosmetic, pharmaceutical, and material industry. Therefore, modification of ferulic acid should be made by producing of more lipophilic derivatives. In this study, a preliminary investigation of lipase-catalyzed trans-esterification reaction of ethyl ferulate and olive oil was investigated. The reaction was catalyzed by immobilized lipase from Candida antarctica (Novozym 435), to produce ferulate ester, a sunscreen agent. A statistical approach of Response surface methodology (RSM) was used to evaluate the interactive effects of reaction temperature (40-80°C), reaction time (4-12 hours), and amount of enzyme (0.1-0.5 g). The optimum conditions derived via RSM were reaction temperature 60°C, reaction time 2.34 hours, and amount of enzyme 0.3 g. The actual experimental yield was 59.6% ferulate ester under optimum condition, which compared well to the maximum predicted value of 58.0%.
Abstract: The present study is an analysis of the forced convection heat transfer in porous channel with an oriented jet at the inlet with uniform velocity and temperature distributions. The upper wall is insulated when the bottom one is kept at constant temperature higher than that of the fluid at the entrance. The dynamic field is analysed by the Brinkman-Forchheimer extended Darcy model and the thermal field is traduced by the energy one equation model. The numerical solution of the governing equations is obtained by using the finite volume method. The results mainly concern the effect of Reynolds number, jet angle and thermal conductivity ratio on the flow structure and local and average Nusselt numbers evolutions.
Abstract: Except for the internal aspects of entrepreneurship (i.e.motivation, opportunity perspective and alertness), there are external aspects that affecting entrepreneurship (i.e. the industrial cluster). By comparing the machinery companies located inside and outside the industrial district, this study aims to explore the cluster effects on the entrepreneurship of companies in Taiwan machinery clusters (TMC). In this study, three factors affecting the entrepreneurship in TMC are conducted as “competition”, “embedded-ness” and “specialized knowledge”. The “competition” in the industrial cluster is defined as the competitive advantages that companies gain in form of demand effects and diversified strategies; the “embedded-ness” refers to the quality of company relations (relational embedded-ness) and ranges (structural embedded-ness) with the industry components (universities, customers and complementary) that affecting knowledge transfer and knowledge generations; the “specialized knowledge” shares theinternal knowledge within industrial clusters. This study finds that when comparing to the companieswhich are outside the cluster, the industrial cluster has positive influence on the entrepreneurship. Additionally, the factor of “relational embedded-ness” has significant impact on the entrepreneurship and affects the adaptation ability of companies in TMC. Finally, the factor of “competition” reveals partial influence on the entrepreneurship.
Abstract: Blood gamma irradiation is the only available method
to prevent transfusion associated graft versus host disease (TAGVHD).
However, when blood is irradiated, determine blood shelf
time is crucial. Non irradiated blood have a self-time from 21 to 35
days when is preserved with anticoagulated solution and stored at
4°C. During their storage, red blood cells (RBC) undergo a series of
biochemical, biomechanical and molecular changes involving what is
known as storage lesion (SL). SL include loss of structural integrity
of RBC, decrease of 2,3-diphosphatidylglyceric acid levels, and
increase of both ion potassium concentration and hemoglobin (Hb).
On the other hand, Atomic force Microscopy (AFM) represents a
versatile tool for a nano-scale high resolution topographic analysis in
biological systems. In order to evaluate SL in irradiated and nonirradiated
blood, RBC topography and morphometric parameters
were obtained from an AFM XE-BIO system. Cell viability was
followed using flow cytometry. Our results showed that early
markers as nanoscale roughness, allow us to evaluate blood quality
since other perspective.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Flanges are widely used for connecting valves, pipes and other industrial devices such as gearboxes. Method of producing a flange has a considerable impact on the manner of their involvement with the industrial engines and gearboxes. By Using die casting instead of sand casting and machining for manufacturing flanges, production speed and dimensional accuracy of the parts increases. Also, in die casting, obtained dimensions are close to final dimensions and hence the need for machining flanges after die casting process decreases which makes a significant savings in raw materials and improves the mechanical properties of flanges. In this paper, a typical die of an industrial helical gearbox flange (size ISO 50) was designed and die casting process for producing this type of flange was simulated using ProCAST software. The results of simulation were used for optimizing die design. Finally, using the results of the analysis, optimized die was built.
Abstract: This study deals with an advanced numerical
techniques to detect tensile forces in cable-stayed structures. The
proposed method allows us not only to avoid the trap of minimum at
initial searching stage but also to find their final solutions in better
numerical efficiency. The validity of the technique is numerically
verified using a set of dynamic data obtained from a simulation of the
cable model modeled using the finite element method. The results
indicate that the proposed method is computationally efficient in
characterizing the tensile force variation for cable-stayed structures.
Abstract: This study aimed to analyse the application of
sufficiency economy in students’ ways of life on campus at Suan
Sunandha Rajabhat University. Data was gathered through 394
questionnaires. The study results found that the majority of students
were confident that “where there’s a will, there’s a way.” Overall, the
students applied the sufficiency economy at a great level, along with
being persons who do not exploit others, were satisfied with living
their lives moderately, according to the sufficiency economy.
Importance was also given to kindness and generosity. Importantly,
students were happy with living according to their individual
circumstances and status at the present. They saw the importance of
joint life planning, self-development, and self-dependence, always
learning to be satisfied with “adequate”. As for their practices and
ways of life, socially relational activities rated highly, especially
initiation activities for underclassmen at the university and the
seniority system, which are suitable for activities on campus.
Furthermore, the students knew how to build a career and find
supplemental income, knew how to earnestly work according to
convention to finish work, and preferred to study elective subjects
which directly benefit career-wise. The students’ application of
sufficiency economy philosophy principles depended on their lives in
their hometowns. The students from the provinces regularly applied
sufficiency economy philosophy to their lives, for example, by being
frugal, steadfast, determined, avoiding negligence, and making
economical spending plans; more so than the students from the
capital.
Abstract: The Montreal protocol and Kyoto protocol underlined the need of substitution of CFC’s and HCFC’s due to their adverse impact on atmospheric ozone layer which protects earth from U.V rays. The CFCs have been entirely ruled out since 1995 and a long-term basis HCFCs must be replaced by 2020. All this events motivated HFC refrigerants which are harmless to ozone layer. In this paper thermodynamic analysis of cascade refrigeration system has been done using three different refrigerant pairs R13-R12, R290-R23, and R404A-R23. Effect of various operating parameters i.e. evaporator temperature, condenser temperature, temperature difference in cascade condenser and low temperature cycle condenser temperature on performance parameters viz. COP, exergetic efficiency and refrigerant mass flow ratio have been studied. Thermodynamic analysis shows that out of three refrigerant pairs R12-R13, R290-R23 and R404A-R23 the COP of R290-R23 refrigerant pair is highest.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.