Abstract: Reliability allocation is quite important during early
design and development stages for a system to apportion its specified
reliability goal to subsystems. This paper improves the reliability
fuzzy allocation method, and gives concrete processes on determining
the factor and sub-factor sets, weight sets, judgment set, and
multi-stage fuzzy evaluation. To determine the weight of factor and
sub-factor sets, the modified trapezoidal numbers are proposed to
reduce errors caused by subjective factors. To decrease the fuzziness
in fuzzy division, an approximation method based on linear
programming is employed. To compute the explicit values of fuzzy
numbers, centroid method of defuzzification is considered. An
example is provided to illustrate the application of the proposed
reliability allocation method based on fuzzy arithmetic.
Abstract: This study was conducted Razakı grape variety (Vitis
vinifera L.) and its vine which was aged 19 was grown on 5 BB
rootstock in a vegetation period of 2014 in Afyon province in Turkey.
In this research, it was investigated whether the applications of
Control (C), 1/3 Cluster Tip Reduction (1/3 CTR), Shoot Tip
Reduction (STR), 1/3 CTR + STR, Boric Acid (BA), 1/3 CTR + BA,
STR + BA, 1/3 CTR + STR + BA on yield and yield components of
Razakı grape variety. The results were obtained as the highest fresh
grape yield (7.74 kg/vine) with C application; as the highest cluster
weight (244.62 g) with STR application; as the highest 100 berry
weight (504.08 g) with C application; as the highest maturity index
(36.89) with BA application; as the highest must yield (695.00 ml)
with BA and (695.00 ml) with 1/3 CTR + STR + BA applications; as
the highest intensity of L* color (46.93) with STR and (46.10) with
1/3 CTR + STR + BA applications; as the highest intensity of a*
color (-5.37) with 1/3 CTR + STR and (-5.01) with STR, as the
highest intensity of b* color (12.59) with STR application. The shoot
tip reduction to increase cluster weight and boric acid application to
increase maturity index of Razakı grape variety can be recommended.
Abstract: Array-based gene expression analysis is a powerful
tool to profile expression of genes and to generate information on
therapeutic effects of new anti-cancer compounds. Anti-apoptotic
effect of thymoquinone was studied in MCF7 breast cancer cell line
using gene expression profiling with cDNA microarray. The purity
and yield of RNA samples were determined using RNeasyPlus Mini
kit. The Agilent RNA 6000 NanoLabChip kit evaluated the quantity
of the RNA samples. AffinityScript RT oligo-dT promoter primer
was used to generate cDNA strands. T7 RNA polymerase was used to
convert cDNA to cRNA. The cRNA samples and human universal
reference RNA were labelled with Cy-3-CTP and Cy-5-CTP,
respectively. Feature Extraction and GeneSpring softwares analysed
the data. The single experiment analysis revealed involvement of 64
pathways with up-regulated genes and 78 pathways with downregulated
genes. The MAPK and p38-MAPK pathways were
inhibited due to the up-regulation of PTPRR gene. The inhibition of
p38-MAPK suggested up-regulation of TGF-ß pathway. Inhibition of
p38-MAPK caused up-regulation of TP53 and down-regulation of
Bcl2 genes indicating involvement of intrinsic apoptotic pathway.
Down-regulation of CARD16 gene as an adaptor molecule regulated
CASP1 and suggested necrosis-like programmed cell death and
involvement of caspase in apoptosis. Furthermore, down-regulation
of GPCR, EGF-EGFR signalling pathways suggested reduction of
ER. Involvement of AhR pathway which control cytochrome P450
and glucuronidation pathways showed metabolism of Thymoquinone.
The findings showed differential expression of several genes in
apoptosis pathways with thymoquinone treatment in estrogen
receptor-positive breast cancer cells.
Abstract: An experiment was conducted to determine the effect
of pollination on seed quality of rapeseed in Chitwan, Nepal during
2012-2013. The experiment was designed in Randomized Complete
Block with four replications and five treatments. The rapeseed plots
were caged with mosquito nets at 10% flowering except natural
pollination. Two-framed colonies of Apis mellifera L. and Apis
cerana F. were introduced separately for pollination, and control plot
caged without pollinators. The highest germination percent was
observed on Apis cerana F. pollinated plot seeds (90.50%
germination) followed by Apis mellifera L. pollinated plots (87.25 %)
and lowest on control plots (42.00% germination) seeds. Similarly,
seed test weight of Apis cerana F. pollinated plots (3.22 gm/ 1000
seed) and Apis mellifera L. pollinated plots (2.93 gm/1000 seed) were
and lowest on control plots (2.26 gm/ 1000 seed) recorded. Likewise,
oil content was recorded highest on pollinated by Apis cerana F.
(36.1%) followed by pollinated by Apis mellifera L. (35.4%) and
lowest on control plots (32.8%). This study clearly indicated
pollination increases the seed quality of rapeseed and therefore,
management of honeybee is necessary for producing higher quality of
rapeseed under Chitwan condition.
Abstract: Medulloblastoma (MB) is one of the most prevalent
brain tumours among paediatrics. Although its management has
evolved over time still there is need to find new therapeutic targets
for MB that can result in less normal tissue toxicity while improving
survival and reducing recurrence. This literature review is aimed at
finding new potential therapeutic targets for MB focusing on viruses
that can be used as potential targets for MB. The review also gives an
over-view of management of paediatric Medulloblastoma focusing on
Radiotherapy management.
Abstract: Sports games conducted as a group are a form of
therapeutic exercise for aged people with decreased strength and for
people suffering from permanent damage of stroke and other
conditions. However, it is difficult for patients with different athletic
abilities to play a game on an equal footing. This study specifically
examines a computer video game designed for therapeutic exercise,
and a game system with support given depending on athletic ability.
Thereby, anyone playing the game can participate equally. This
video-game, to be specific, is a popular variant of balloon volleyball,
in which players hit a balloon by hand before it falls to the floor. In this
game system, each player plays the game watching a monitor on which
the system displays tailor-made video-game images adjusted to the
person’s athletic ability, providing players with player-adaptive assist
support. We have developed a multiplayer game system with an image
generation technique for the tailor-made video-game and conducted
tests to evaluate it.
Abstract: Essential oils are expensive phytochemicals produced
and extracted from specific species belonging to particular families in
the plant kingdom. In the United Arab Emirates country (UAE), is
located in the arid region of the world, nine species, from the
Lamiaceae family, having the capability to produce therapeutic grade
essential oils. These species include; Mentha spicata, Ocimum
forskolei, Salvia macrosiphon, Salvia aegyptiaca, Salvia macilenta,
Salvia spinosa, Teucrium polium, Teucrium stocksianum and Zataria
multiflora. Although, such potential species are indigenous to the
UAE, however, there are almost no studies available to investigate
the chemical composition and the quality of the extracted essential
oils under the UAE climatological conditions. Therefore, great
attention has to be given to such valuable natural resources, through
conducting highly supported research projects, tailored to the UAE
conditions, and investigating different extraction techniques,
including the application of the latest available technologies, such as
superficial fluid CO2. This is crucially needed; in order to accomplish
the greatest possibilities in the medicinal field, specifically in the
discovery of new therapeutic chemotypes, as well as, to achieve the
sustainability of this natural resource in the country.
Abstract: The liver is the strongest regenerating organ of the
organism, and even with 2/3 surgically removed, it can regenerate
completely. Hence liver cirrhosis may only develop when the
regenerating system is off.
We present the results of a comparative study of structural and
functional characteristics of rat liver tissue under the conditions of
toxic liver cirrhosis development, induced by carbon tetrachloride,
and its prevention/treatment by natural compounds with antioxidant
and immune stimulating action. Studies were made on Wister rats,
weighing 120~140 g. Grape seeds extracts, separately and in
combination with well-known anticirrhotic drug ursodeoxycholic
acid (Urdoxa), have demonstrated effectiveness in prevention of liver
cirrhosis development and its treatment.
Abstract: The bean (Phaseolus vulgaris L.) is one of the best
known of the legumes, and it has a long cultivation tradition in Italy.
The territory of “Subappennino Dauno” (southern Italy) is at around
700 m a.s.l. and is predominantly grown with cereals, olive trees and
grapevines. Ecotypes of white beans to eat dry (such as cannellini
beans) are also grown, which are sought for their palatability, high
digestibility, and ease of cooking. However, these are not easy to find
on the market due to their low production in relatively small areas
and on small family farms that use seeds handed down from
generation to generation. The introduction of these ecotypes in plain
areas of the Puglia region would provide an opportunity to promote
the diffusion of this type of bean. To investigate the adaptability of
these ecotypes in plain environments (Cerignola, in southern Italy) a
comparative trial was carried out between three ‘Monti Dauni’
ecotypes (E1, E2, E3) that are native to mountain areas and the
similar commercial variety, ‘Cannellini’. The data provide useful
information about the quantitative and qualitative characteristics of
these ecotypes when grown in lowland environments. Ecotype E3
provided the greatest bean production (2.34 t ha-1) compared to
‘Cannellini’ (1.28 t ha-1) and the other ecotypes (0.55 and 0.40 t ha-1,
for E1 and E2, respectively), due to its greater plant growth and the
larger size of the seed (and thickness, in particular). Finally, ecotype
E2 provided the greatest protein content (31.2%), although not
significantly different from the commercial cultivar ‘Cannellini’
(32.1%).
Abstract: Persea declinata (Bl.) Kosterm is a member of the
Lauraceae family, widely distributed in Southeast Asia. It is from the
same genus with avocado (Persea americana Mill), which is widely
consumed as food and for medicinal purposes. In the present study,
we examined the anticancer properties of Persea declinata (Bl.)
Kosterm bark methanolic crude extract (PDM). PDM exhibited a
potent antiproliferative effect in MCF-7 human breast cancer cells,
with an IC50 value of 16.68 .g/mL after 48h of treatment. We
observed that PDM caused cell cycle arrest and subsequent apoptosis
in MCF-7 cells, as exhibited by increased population at G0/G1 phase,
higher lactate dehydrogenase (LDH) release, and DNA
fragmentation. Mechanistic studies showed that PDM caused
significant elevation in ROS production, leading to perturbation of
mitochondrial membrane potential, cell permeability, and activation
of caspases-3/7. On the other hand, real-time PCR and Western blot
analysis showed that PDM treatment increased the expression of the
proapoptotic molecule, Bax, but decreased the expression of
prosurvival proteins, Bcl-2 and Bcl-xL, in a dose-dependent manner.
These findings imply that PDM could inhibit proliferation in MCF-7
cells via cell cycle arrest and apoptosis induction, indicating its
potential as a therapeutic agent worthy of further development.
Abstract: The manufacturing technology of band cotton is very
delicate and depends to choice of certain parameters such as torsion
of warp yarn.
The fabric elasticity is achieved without the use of any elastic
material, chemical expansion, artificial or synthetic and it’s capable
of creating pressures useful for therapeutic treatments.
Before use, the band is subjected to treatments of specific
preparation for obtaining certain elasticity, however, during its
treatment, there are some regression parameters. The dependence of
manufacturing parameters on the quality of the chemical treatment
was confirmed.
The aim of this work is to improve the properties of the fabric
through the development of manufacturing technology appropriately.
Finally for the treatment of the strip pancake 100% cotton, a
treatment method is recommended.
Abstract: The article presents the trends in Georgian wine
market development and evaluates the competitive advantages of
Georgia to enter the wine market based on its customs, traditions and
historical practices combined with modern technologies.
In order to analyze the supply of wine, dynamics of vineyard land
area and grape varieties are discussed, trends in wine production are
presented, trends in export and import are evaluated, local wine
market, its micro and macro environments are studied and analyzed
based on the interviews with experts and analysis of initial recording
materials.
For strengthening its position on the international market, the level
of competitiveness of Georgian wine is defined, which is evaluated
by “ex-ante” and “ex-post” methods, as well as by four basic and two
additional factors of the Porter’s diamond method; potential
advantages and disadvantages of Georgian wine are revealed.
Conclusions are made by identifying the factors that hinder the
development of Georgian wine market. Based on the conclusions,
relevant recommendations are developed.
Abstract: Azadirachta excelsa or locally known as sentang are
frequently used as a traditional medicine by diabetes patients in
Malaysia. However, less attention has been given to their toxicity
effect. Thus, the study is an attempt to examine the protective effect
of A. excelsa on the pancreas and to determine possible toxicity
mediated by the extract. Diabetes was induced experimentally in rats
by high-fat-diet for 16 weeks followed by intraperitoneal injection of
streptozotocin at dosage of 35 mg/kg of body weight. Declination of
the fasting blood glucose level was observed after continuous
administration of A. excelsa for 14 days twice daily. This is due to the
refining structure of the pancreas. However, surprisingly, the plant
extract reduced the leukocytes, erythrocytes, hemoglobin, MCHC and
lymphocytes. In addition, the rat treated with the plant extract
exhibited increment in AST and eosinocytes level. Overall, the
finding shows that A. excelsa possesses antidiabetic activity by
improving the structure of pancreatic islet of Langerhans but
involved in ameliorating of hematology and biochemical parameters.
Abstract: This study presents the numerical simulation of three-dimensional incompressible steady and laminar fluid flow and conjugate heat transfer of a trapezoidal microchannel heat sink using water as a cooling fluid in a silicon substrate. Navier-Stokes equations with conjugate energy equation are discretized by finite-volume method. We perform numerical computations for a range of 50 ≦ Re ≦ 600, 0.05W ≦ P ≦ 0.8W, 20W/cm2 ≦q"≦ 40W/cm2. The present study demonstrates the numerical optimization of a trapezoidal microchannel heat sink design using the response surface methodology (RSM) and the genetic algorithm method (GA). The results show that the average Nusselt number increases with an increase in the Reynolds number or pumping power, and the thermal resistance decreases as the pumping power increases. The thermal resistance of a trapezoidal microchannel is minimized for a constant heat flux and constant pumping power.
Abstract: This paper presents the findings from a numerical simulation of the flow in 37-rod fuel assembly models spaced by a double-wire trapezoidal wrapping as applied to the BREST-OD-300 experimental nuclear reactor. Data on a high static pressure distribution within the models, and equations for determining the fuel bundle flow friction factors have been obtained. Recommendations are provided on using the closing turbulence models available in the ANSYS Fluent. A comparative analysis has been performed against the existing empirical equations for determining the flow friction factors. The calculated and experimental data fit has been shown.
An analysis into the experimental data and results of the numerical simulation of the BREST-OD-300 fuel rod assembly hydrodynamic performance are presented.
Abstract: Two new metal-based anticancer chemotherapeutic
agents, [(Ph2Sn)2(HGuO)2(phen)Cl2] 1 and [(Ph3Sn)(HGuO)(phen)]-
Cl.CH3OH.H2O 2, were designed, prepared and characterized by
analytical and spectral (IR, ESI-Mass, 1H, 13C and 119Sn NMR)
techniques. The proposed geometry of Sn(IV) in 1 and 2 is distorted
octahedral and distorted trigonal-bipyramidal, respectively. Both 1
and 2 exhibit potential cytotoxicity in vitro against MCF-7, HepG-2
and DU-145 cell lines. The intrinsic binding constant (Kb) values of 1
(2.33 × 105 M-1) and 2 (2.46 × 105 M-1) evaluated from UV-Visible
absorption studies suggest non-classical electrostatic mode of
interaction via phosphate backbone of DNA double helix. The Stern-
Volmer quenching constant (Ksv) of 1 (9.74 × 105 M-1) and 2 (2.9 ×
106 M-1) determined by fluorescence studies suggests the groove
binding and intercalation mode for 1 and 2, respectively. Effective
cleavage of pBR322 DNA is induced by 1.Their interaction with
DNA of cancer cells may account for potency.
Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.
Abstract: The protective effect of hesperidin was investigated in
rats exposed to liver injury induced by a single intraperitoneal
injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1.
Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven
days, starting five days before CYP administration. Hesperidin
significantly decreased the CYP-induced elevations of serum alanine
aminotransferase, and hepatic malondialdehyde and myeloperoxidase
activity, significantly prevented the depletion of hepatic glutathione
peroxidase activity resulted from CYP administration. Also,
hesperidin ameliorated the CYP-induced liver tissue injury observed
by histopathological examination. In addition, hesperidin decreased
the CYP-induced expression of inducible nitric oxide synthase, tumor
necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in
liver tissue. It was concluded that hesperidin may represent a
potential candidate to protect against CYP-induced hepatotoxicity.
Abstract: Hanging to the trapezoidal sheet by decking hanger is a very widespread solution used in civil engineering to lead the distribution of energy, sanitary, air distribution system etc. under the roof or floor structure. The trapezoidal decking hanger is usually a part of the whole installation system for specific distribution medium. The leading companies offer installation systems for each specific distribution e.g. pipe rings, sprinkler systems, installation channels etc. Every specific part is connected to the base connector which is decking hanger. The own connection has three main components: decking hanger, threaded bar with nuts and web of trapezoidal sheet. The aim of this contribution is determinate the failure mechanism of each component in connection. Load bearing capacity of most components in connection could be calculated by formulas in European codes. This contribution is focused on problematic of bearing resistance of threaded bar in web of trapezoidal sheet. This issue is studied by experimental research and numerical modelling. This contribution presented the initial results of experiment which is compared with numerical model of specimen.
Abstract: The inhibition of SH2 domain regulated protein-protein interactions is an attractive target for developing an effective chemotherapeutic approach in the treatment of disease. Molecular simulation is a useful tool for developing new drugs and for studying molecular recognition. In this study, we searched potential drug compounds for the inhibition of SH2 domain by performing structural similarity search in PubChem Compound Database. A total of 37 compounds were screened from the database, and then we used the LibDock docking program to evaluate the inhibition effect. The best three compounds (AP22408, CID 71463546 and CID 9917321) were chosen for MD simulations after the LibDock docking. Our results show that the compound CID 9917321 can produce a more stable protein-ligand complex compared to other two currently known inhibitors of Src SH2 domain. The compound CID 9917321 may be useful for the inhibition of SH2 domain based on these computational results. Subsequently experiments are needed to verify the effect of compound CID 9917321 on the SH2 domain in the future studies.