B. - Journal Author

Effect of Packaging Methods and Storage Time on Oxidative Stability of Traditional Fermented Sausage

Year: 2014 Volume: 8 Issue: 9 1027 - 1030 Pages

Abstract: In this paper influence of packaging method (vacuum and modified atmosphere packaging) on lipid oxidative stability and sensory properties of odor and taste of the traditional sausage Petrovská klobása were examined. These parameters were examined during storage period (7 months). In the end of storage period, vacuum packed sausage showed better oxidative stability. Propanal content was significantly lower (P

Kinematic Parameters for Asa River Routing

Year: 2014 Volume: 8 Issue: 5 350 - 354 Pages

Abstract: Flood routing is used in estimating the travel time and attenuation of flood waves as they move downstream a river or channel. The routing procedure is usually classified as hydrologic or hydraulic. Hydraulic methods utilize the equations of continuity and motion. Kinematic routing, a hydraulic technique was used in routing Asa River at Ilorin. The river is of agricultural and industrial importance to Ilorin, the capital of Kwara State, Nigeria. This paper determines the kinematic parameters of kinematic wave velocity, time step, time required to traverse, weighting factor and change in length. Values obtained were 4.67 m/s, 19 secs, 21 secs, 0.75 and 100 m, respectively. These parameters adequately reflect the watershed and flow characteristics essential for the routing. The synthetic unit hydrograph was developed using the Natural Resources Conservation Service (NRCS) method. 24-hr 10yr, 25yr, 50yr and 100yr storm hydrographs were developed from the unit hydrograph using convolution procedures and the outflow hydrographs were obtained for each of 24-hr 10yr, 25yr, 50yr and 100yr indicating 0.11 m3/s, 0.10 m3/s, 0.10 m3/s and 0.10 m3/s attenuations respectively.

Simulation of Immiscibility Regions in Sodium Borosilicate Glasses

Year: 2014 Volume: 8 Issue: 8 826 - 829 Pages

Abstract: In this paper, sodium borosilicates glasses were prepared by melting in air. These heat-resistant transparent glasses have subjected subsequently isothermal treatments at different times, which have transformed them at opaque glass (milky white color). Such changes indicate that these glasses showed clearly phase separation (immiscibility). The immiscibility region in a sodium borosilicate ternary system was investigated in this work, i.e. to determine the regions from which some compositions can show phase separation. For this we went through the conditions of thermodynamic equilibrium, which were translated later by mathematical equations to find an approximate solution. The latter has been translated in a simulation which was established thereafter to find the immiscibility regions in this type of special glasses.

Age-Based Interface Design for Children’s CAPT Systems

Year: 2014 Volume: 8 Issue: 8 2649 - 2653 Pages

Abstract: Children today use computer based application in various activities especially for learning and education. Many of these tools and application such as the Computer Aided Pronunciation Training (CAPT) systems enable children to explore and experience them with little supervision from the adults. In order for these tools and application to have maximum effect on the children’s learning and education, it must be attractive to the children to use them. This could be achieved with the proper user interface (UI) design. As children grow, so do their ability, taste and preferences. They interact differently with these applications as they grow older. This study reviews several articles on how age factors influence the UI design. The review focuses on age related abilities such as cognitive, literacy, concentration and feedback requirement. We have also evaluated few of existing CAPT systems and determine the influence of age-based factors on the interface design.

Effects of Varying Air Temperature in the Polishing Component of Single-Pass Mill on the Quality of Rice

Year: 2014 Volume: 8 Issue: 7 772 - 775 Pages

Abstract: The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.

Effects of Different Sowing Dates on Oil Yield of Castor (Ricinus communis L.)

Year: 2014 Volume: 8 Issue: 2 184 - 188 Pages

Abstract: Castor (Ricinus communis L.) is one of the important non-edible oilseed crops having immense industrial and medicinal value. Oil yield per unit area is the ultimate target in growing oilseed plants and sowing date is one of the important factors which have a clear role on production of active substances particularly in oilseeds. This study was conducted to evaluate the effect of sowing date on the seed and oil yield of castor in Central Anatolia of Turkey in 2011. The field experiment was set up in a completely randomized block design with three replications. Black Diamond-2 castor cultivar was used as plant material. The treatment was four sowing dates of May 10, May 25, June 10, June 25. In this research; seed yield, oil content and oil yield were investigated. Results showed that the effect of different sowing dates were significant on all of characteristics. In general; delayed sowing dates, resulted in decreased seed yield, oil content and oil yield. The highest value of seed yield, oil content and oil yield (respectively, 2523.7 kg ha-1, 51.18% and 1292.2 kg ha-1) were obtained from the first sowing date (May 10) while the lowest seed yield, oil content and oil yield (respectively, 1550 kg ha-1, 43.67%, 677.3 kg ha-1) were recorded from the latest sowing date (June 25). Therefore, it can be concluded that early May could be recommended as an appropriate sowing date in the studied location and similar climates for achieved high oil yield of castor.

Factors Impacting Entrepreneurial Intention: A Literature Review

Year: 2014 Volume: 8 Issue: 8 2622 - 2625 Pages

Abstract: Entrepreneurship has captured the attention of policy-makers, educators and researchers in the last few decades. It has been regarded as a main driver for economic growth, development and employment generation in many countries worldwide. However, scholars have not agreed on the key factors that impact entrepreneurial intention. This study attempts, through an extensive literature review, to provide a holistic view and a more comprehensive understanding of the key factors that lead university undergraduate students to become entrepreneurs. A systematic literature review is conducted and several scientific articles and reports have been examined. The results of this study indicate that there are four main sets of factors: the personality-traits factors, contextual factors, motivational factors, and personal background factors. This research will serve as a base for future studies and will have valuable implications for policy makers and educators.

Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Year: 2014 Volume: 8 Issue: 7 765 - 771 Pages

Abstract: Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Physical and Thermo-Physical Properties of High Strength Concrete Containing Raw Rice Husk after High Temperature Effect

Year: 2014 Volume: 8 Issue: 8 881 - 886 Pages

Abstract: High temperature is one of the most detrimental effects that cause important changes in concrete’s mechanical, physical, and thermo-physical properties. As a result of these changes, especially high strength concrete (HSC), may exhibit damages such as cracks and spallings. To overcome this problem, incorporating polymer fibers such as polypropylene (PP) in concrete is a very well-known method. In this study, using RRH, as a sustainable material, instead of PP fiber in HSC to prevent spallings and improve physical and thermo-physical properties were investigated. Therefore, seven HSC mixtures with 0.25 water to binder ratio were prepared incorporating silica fume and blast furnace slag. PP and RRH were used at 0.2-0.5% and 0.5-3% by weight of cement, respectively. All specimens were subjected to high temperatures (20 (control), 300, 600 and 900˚C) with a heating rate of 2.5˚C/min and after cooling, residual physical and thermo-physical properties were determined.

Medical Image Fusion Based On Redundant Wavelet Transform and Morphological Processing

Year: 2014 Volume: 8 Issue: 6 1036 - 1040 Pages

Abstract: The process in which the complementary information from multiple images is integrated to provide composite image that contains more information than the original input images is called image fusion. Medical image fusion provides useful information from multimodality medical images that provides additional information to the doctor for diagnosis of diseases in a better way. This paper represents the wavelet based medical image fusion algorithm on different multimodality medical images. In order to fuse the medical images, images are decomposed using Redundant Wavelet Transform (RWT). The high frequency coefficients are convolved with morphological operator followed by the maximum-selection (MS) rule. The low frequency coefficients are processed by MS rule. The reconstructed image is obtained by inverse RWT. The quantitative measures which includes Mean, Standard Deviation, Average Gradient, Spatial frequency, Edge based Similarity Measures are considered for evaluating the fused images. The performance of this proposed method is compared with Pixel averaging, PCA, and DWT fusion methods. When compared with conventional methods, the proposed framework provides better performance for analysis of multimodality medical images.

Qualitative Characteristics of Meat from Lambs Fed Hydrolyzed Sugarcane

Year: 2014 Volume: 8 Issue: 7 707 - 709 Pages

Abstract: We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.

DNA Methylation Changes Caused by Lawsone

Year: 2014 Volume: 8 Issue: 7 699 - 702 Pages

Abstract: Lawsone is a pigment that occurs naturally in plants. It has been used as a skin and hair dye for a long time. Moreover, its different biological activities have been reported. The present study focused on the effect of lawsone on a plant cell model represented by tobacco BY-2 cell suspension culture, which is used as a model comparable with the HeLa cells. It has been shown that lawsone inhibits the cell growth in the concentration-dependent manner. In addition, changes in DNA methylation level have been determined. We observed decreasing level of DNA methylation in the presence of increasing concentrations of lawsone. These results were accompanied with overproduction of reactive oxygen species (ROS). Since epigenetic modifications can be caused by different stress factors, there could be a connection between the changes in the level of DNA methylation and ROS production caused by lawsone.

Influence of Culture Conditions on the Growth and Fatty Acid Composition of Green Microalgae Oocystis rhomboideus, Scenedesmus obliquus, Dictyochlorella globosa

Year: 2014 Volume: 8 Issue: 6 626 - 630 Pages

Abstract: Microalgae due to the ability to accumulate high levels of practically valuable polyunsaturated fatty acids attract attention as a promising raw material for commercial products. The features of the growth processes of cells green protococcal microalgae Oocystis rhomboideus, Scenedesmus obliquus, Dictyochlorella globosa at cultivation in different nutritional mediums were determined. For the rapid accumulation of biomass, combined with high productivity of total lipids fraction yield recommended to use the Fitzgerald medium (Scenodesmus obliquus, Oocystis rhomboideus) and/or Bold medium (Dictyochlorella globosa). Productivity of lipids decreased in sequence Dictyochlorella globosa > Scenodesmus obliquus > Oocystis rhomboideus. The bulk of fatty acids fraction of the total lipids is unsaturated fatty acids, which accounts for 70 to 83% of the total number of fatty acids. The share of monoenic acids accounts from 18 to 34%, while the share of unsaturated fatty acids - from 44 to 62% of the total number of unsaturated fatty acids fraction. Among the unsaturated acids dominate α-linolenic acid (C18:3n-3), hexadecatetraenic acid (C16:4) and linoleic acid (C18:2).

Phasor Analysis of a Synchronous Generator: A Bond Graph Approach

Year: 2014 Volume: 8 Issue: 7 1106 - 1112 Pages

Abstract: This paper presents the use of phasor bond graphs to obtain the steady-state behavior of a synchronous generator. The phasor bond graph elements are built using 2D multibonds, which represent the real and imaginary part of the phasor. The dynamic bond graph model of a salient-pole synchronous generator is showed, and verified viz. a sudden short-circuit test. The reduction of the dynamic model into a phasor representation is described. The previous test is executed on the phasor bond graph model, and its steady-state values are compared with the dynamic response. Besides, the widely used power (torque)-angle curves are obtained by means of the phasor bond graph model, to test the usefulness of this model.

Analysis of Electrical Networks Using Phasors: A Bond Graph Approach

Year: 2014 Volume: 8 Issue: 7 1099 - 1105 Pages

Abstract: This paper proposes a phasor representation of electrical networks by using bond graph methodology. A so-called phasor bond graph is built up by means of two-dimensional bonds, which represent the complex plane. Impedances or admittances are used instead of the standard bond graph elements. A procedure to obtain the steady-state values from a phasor bond graph model is presented. Besides the presentation of a phasor bond graph library in SIDOPS code, also an application example is discussed.

The Statistical Significant of Adsorbents for Effective Zn (II) Ions Removal

Year: 2014 Volume: 8 Issue: 7 500 - 502 Pages

Abstract: The adsorption efficiency of various adsorbents for the removal of Zn(II) ions from the waste printing developer was studied in laboratory batch mode. The maximum adsorption efficiency of 94.1% was achieved with unfired clay pellets size (d ≈ 15 mm). The obtained values of adsorption efficiency was subjected to the independent-samples t test in order to investigate the statistically significant differences of the investigated adsorbents for the effective removal of Zn(II) ions from the waste printing developer. The most statistically significant differences of adsorption efficiencies for Zn(II) ions removal were obtained between unfired clay pellets (size d ≈ 15 mm) and activated carbon (½t½=6.909), natural zeolite (½t½=10.380), mixture of activated carbon and natural zeolite (½t½=9.865), bentonite (½t½=6.159), fired clay (½t½=6.641), fired clay pellets (size d ≈ 5 mm) (½t½=6.678), fired clay pellets (size d ≈ 8 mm) (½t½=3.422), respectively.

Optimization of Energy Harvesting Systems for RFID Applications

Year: 2014 Volume: 8 Issue: 7 1167 - 1170 Pages

Abstract: To avoid battery assisted tags with limited lifetime batteries, it is proposed here to replace them by energy harvesting systems, able to feed from local environment. This would allow total independence to RFID systems, very interesting for applications where tag removal from its location is not possible. Example is here described for luggage safety in airports, and is easily extendable to similar situation in terms of operation constraints. The idea is to fix RFID tag with energy harvesting system not only to identify luggage but also to supply an embedded microcontroller with a sensor delivering luggage weight making it impossible to add or to remove anything from the luggage during transit phases. The aim is to optimize the harvested energy for such RFID applications, and to study in which limits these applications are theoretically possible. Proposed energy harvester is based on two energy sources: piezoelectricity and electromagnetic waves, so that when the luggage is moving on ground transportation to airline counters, the piezo module supplies the tag and its microcontroller, while the RF module operates during luggage transit thanks to readers located along the way. Tag location on the luggage is analyzed to get best vibrations, as well as harvester better choice for optimizing the energy supply depending on applications and the amount of energy harvested during a period of time. Effects of system parameters (RFID UHF frequencies, limit distance between the tag and the antenna necessary to harvest energy, produced voltage and voltage threshold) are discussed and working conditions for such system are delimited.

Zhou Enlai’s Impact to the Foreign Folicy of China

Year: 2014 Volume: 8 Issue: 3 874 - 877 Pages

Authors:
Nazira B. Boldurukova

Abstract: The main aim of this article is to give the information about life and social and diplomatic work of Zhou Enlai, to prove his identity in his impact to the history of the world; to show his place in the organization of internal and foreign policy and in the peaceful international relationships of China with other countries.

Chromium Adsorption by Modified Wood

Year: 2014 Volume: 8 Issue: 6 578 - 580 Pages

Abstract: Chromium is one of the most common heavy metals which exist in very high concentrations in wastewater. The removal is very expensive due to the high cost of normal adsorbents. Lignocellulosic materials and mainly treated materials have proven to be a good solution for this problem. Adsorption tests were performed at different pH, different times and with varying concentrations. Results show that is at pH 3 that treated wood absorbs more chromium ranging from 70% (2h treatment) to almost 100% (12 h treatment) much more than untreated wood with less than 40%. Most of the adsorption is made in the first 2-3 hours for untreated and heat treated wood. Modified wood adsorbs more chromium throughout the time. For all the samples, adsorption fitted relatively well the Langmuir model with correlation coefficient ranging from 0.85 to 0.97. The results show that heat treated wood is a good adsorbent ant that this might be a good utilization for sawdust from treating companies.

Nutrients Removal Control via an Intermittently Aerated Membrane Bioreactor

Year: 2014 Volume: 8 Issue: 6 560 - 563 Pages

Abstract: Nitrogen is among the main nutrients encouraging the growth of organic matter and algae which cause eutrophication in water bodies. Therefore, its removal from wastewater has become a worldwide emerging concern. In this research, an innovative Membrane Bioreactor (MBR) system named “moving bed membrane bioreactor (MBMBR)” was developed and investigated under intermittently-aerated mode for simultaneous removal of organic carbon and nitrogen. Results indicated that the variation of the intermittently aerated duration did not have an apparent impact on COD and NH4+–N removal rate, yielding the effluent with average COD and NH4+–N removal efficiency of more than 92 and 91% respectively. However, in the intermittently aerated cycle of (continuously aeration/0s mix), (aeration 90s/mix 90s) and (aeration 90s/mix 180s); the average TN removal efficiency was 67.6%, 69.5% and 87.8% respectively. At the same time, their nitrite accumulation rate was 4.5%, 49.1% and 79.4% respectively. These results indicate that the intermittently aerated mode is an efficient way to controlling the nitrification to stop at nitrition; and also the length of anoxic duration is a key factor in improving TN removal.

Top Journal

SUGGEST A JOURNAL